Strain Report - Rat Genome Database

Send us a Message



Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   

Strain: SD-Nfe2l2em1Mcwi

Symbol: SD-Nfe2l2em1Mcwi
Strain: SD-Nfe2l2em1
Substrain: Mcwi
RGD ID: 9588552
Citation ID: RRID:RGD_9588552
Ontology ID: RS:0003831
Alleles: Nfe2l2em1Mcwi
Also Known As: SD-Nfe2l2em1Mcwi; SD-Nfe2l2^[em1Mcwi]
Type: mutant
Available Source: Not Available
Origination: PhysGen Knockouts
Description: This strain was produced by injecting TALENs targeting the sequence TAGTCCTGGCGGTGGCAATTCCAAGTCCATCATGCTGAGGGCGGACGCTGCGCTA into Crl:SD Sprague Dawley rat embryos. The resulting mutation is a 41-bp deletion in exon 1.
Last Known Status: Live Animals (as of 2017-01-26)
Position
Rat AssemblyChrPosition (strand)SourceJBrowse
mRatBN7.2360,621,570 - 60,621,610RGD_MAPPER_PIPELINEmRatBN7.2
Rnor_6.0362,524,893 - 62,524,933RGD_MAPPER_PIPELINERnor6.0
Rnor_5.0369,041,641 - 69,069,190RGD_MAPPER_PIPELINERnor5.0
RGSC_v3.4358,366,693 - 58,394,116RGD_MAPPER_PIPELINERGSC3.4






References

References - curated
# Reference Title Reference Citation
1. Knockout rats via embryo microinjection of zinc-finger nucleases. Geurts AM, etal., Science. 2009 Jul 24;325(5939):433.
2. PhysGen Knockouts PhysGen Knockout strains
3. RGD Strain RSO annotation pipeline RGD Automated Pipelines

Region

Allelic Variants
Name Chromosome Start Pos End Pos Reference Nucleotide Variant Nucleotide Variant Type Assembly
Nfe2l2em1Mcwi-var1 chr3 60621570 60621610 TGTAGTCCTGGCGGTGGCAATTCCAAGTCCATCATGCTGAG - deletion mRatBN7.2
Nfe2l2em1Mcwi-var1 chr3 62524893 62524933 TGTAGTCCTGGCGGTGGCAATTCCAAGTCCATCATGCTGAG - deletion Rnor_6.0

Additional Information


Nomenclature History
Date Current Symbol Current Name Previous Symbol Previous Name Description Reference Status
2015-04-24 SD-Nfe2l2em1Mcwi    SD-Nfe2l2em1Mcwi    Name updated 68913 APPROVED
2015-04-24 SD-Nfe2l2em1Mcwi    SD-Nfe2l2em1Mcwi    Name updated 68913 APPROVED