Strain Report - Rat Genome Database

Send us a Message



Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   

Strain: SS-Apoeem9Mcwi

Symbol: SS-Apoeem9Mcwi
Strain: SS-Apoeem9
Substrain: Mcwi
RGD ID: 7364879
Citation ID: RRID:RGD_7364879
Ontology ID: RS:0003525
Alleles: Apoeem9Mcwi
Also Known As: SS-Apoeem9Mcwi; SS-Apoe^[em9Mcwi]
Type: mutant
Available Source: Not Available
Origination: PhysGen Knockouts
Description: This strain was produced by injecting ZFNs targeting the sequence CAGGCCCTGAACCGCttctggGATTACCTGCGCTGGG into SS/JrHsdMcwi rat embryos. The resulting mutation is a 101-bp deletion in exon 2 and intron 3
Last Known Status: Cryopreserved Sperm (as of 2017-01-26)
Position
Rat AssemblyChrPosition (strand)SourceJBrowse
mRatBN7.2179,353,924 - 79,357,852RGD_MAPPER_PIPELINEmRatBN7.2
Rnor_6.0180,614,112 - 80,614,212RGD_MAPPER_PIPELINERnor6.0
Rnor_5.0181,878,372 - 81,882,298RGD_MAPPER_PIPELINERnor5.0
RGSC_v3.4179,003,634 - 79,006,387RGD_MAPPER_PIPELINERGSC3.4






References

References - curated
# Reference Title Reference Citation
1. Knockout rats via embryo microinjection of zinc-finger nucleases. Geurts AM, etal., Science. 2009 Jul 24;325(5939):433.
2. PhysGen Knockouts PhysGen Knockout strains
3. RGD Strain RSO annotation pipeline RGD Automated Pipelines

Region

Allelic Variants
Name Chromosome Start Pos End Pos Reference Nucleotide Variant Nucleotide Variant Type Assembly
Apoeem9Mcwi-var1 chr1 80614112 80614212 AAGCGCTGAGCACTCACGTCAGTTCCTGTGTGACTTGGGAGCTCTGCAGCTCTTCCTGGACCTGGTCAGAAAGCGTCTGCACCCAGCGCAGGTAATCCCAG - deletion Rnor_6.0

Additional Information


Nomenclature History
Date Current Symbol Current Name Previous Symbol Previous Name Description Reference Status
2014-04-03 SS-Apoeem9Mcwi    SS-Apoeem9Mcwi    Symbol updated 68687 APPROVED
2014-04-03 SS-Apoeem9Mcwi    SS-Apoeem9Mcwi    Name updated 68913 APPROVED
2014-04-03 SS-Apoeem9Mcwi    SS-Apoeem9Mcwi    Symbol updated 68687 APPROVED
2014-04-03 SS-Apoeem9Mcwi    SS-Apoeem9Mcwi    Name updated 68913 APPROVED