Strain Report - Rat Genome Database

Send us a Message



Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   

Strain: SS-Gnb3em1Mcwi

Symbol: SS-Gnb3em1Mcwi
Strain: SS-Gnb3em1
Substrain: Mcwi
RGD ID: 6484577
Citation ID: RRID:RGD_6484577
Ontology ID: RS:0003271
Alleles: Gnb3em1Mcwi
Also Known As: SS-Gnb3em1Mcwi; SS-Gnb3^[em1Mcwi]
Type: mutant
Available Source: Not Available
Origination: PhysGen Knockouts
Description: This strain was produced by injecting ZFNs targeting the sequence GGCTCCCTCTCTCCTGGCagtccTTGTGGGACATTGAG into SS/JrHsdMcwi rat embryos. The resulting mutation is a 111-bp deletion overlapping exon 7.
Last Known Status: Cryopreserved Sperm (as of 2017-01-26)
Position
Rat AssemblyChrPosition (strand)SourceJBrowse
mRatBN7.24157,639,468 - 157,645,171RGD_MAPPER_PIPELINEmRatBN7.2
Rnor_6.04157,355,400 - 157,355,510RGD_MAPPER_PIPELINERnor6.0
Rnor_5.04224,370,234 - 224,376,918RGD_MAPPER_PIPELINERnor5.0
RGSC_v3.44160,957,524 - 160,963,226RGD_MAPPER_PIPELINERGSC3.4






References

References - curated
# Reference Title Reference Citation
1. Knockout rats via embryo microinjection of zinc-finger nucleases. Geurts AM, etal., Science. 2009 Jul 24;325(5939):433.
2. PhysGen Knockouts PhysGen Knockout strains
3. RGD Strain RSO annotation pipeline RGD Automated Pipelines

Region

Allelic Variants
Name Chromosome Start Pos End Pos Reference Nucleotide Variant Nucleotide Variant Type Assembly
Gnb3em1Mcwi-var1 chr4 157355400 157355510 GCACTGCCAGGAGAGAGGGAGCCCATCACAGAGAAATGTCACAGTTGCCCAGGACAGGGTGACCTTCCTCAGCACCCACGGCATTCAGCCCTTACCACGTGGTGTCCCCAG - deletion Rnor_6.0

Additional Information


Nomenclature History
Date Current Symbol Current Name Previous Symbol Previous Name Description Reference Status
2014-04-03 SS-Gnb3em1Mcwi    SS-Gnb3em1Mcwi    Name updated 68913 APPROVED
2014-04-03 SS-Gnb3em1Mcwi    SS-Gnb3em1Mcwi    Symbol updated 68687 APPROVED
2014-04-03 SS-Gnb3em1Mcwi    SS-Gnb3em1Mcwi    Name updated 68913 APPROVED
2014-04-03 SS-Gnb3em1Mcwi    SS-Gnb3em1Mcwi    Symbol updated 68687 APPROVED
2013-08-15 SS-Gnb3em1Mcwi    SS-Gnb3em1Mcwi    Name updated 68913 APPROVED