Strain Report - Rat Genome Database

Send us a Message

Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   

Strain: SS-Adipoqem1Mcwi

Symbol: SS-Adipoqem1Mcwi
Strain: SS-Adipoqem1
Substrain: Mcwi
RGD ID: 6484576
Citation ID: RRID:RGD_6484576
Ontology ID: RS:0003270
Alleles: Adipoqem1Mcwi
Also Known As: SS-Adipoqem1Mcwi; SS-Adipoq^[em1Mcwi]
Type: mutant
Available Source: Not Available
Origination: PhysGen Knockouts
Description: This strain was produced by injecting ZFNs targeting the sequence CAGGCATCCCAGGATATCctggtcACAATGGGATACCGG into SS/JrHsdMcwi rat embryos. The resulting mutation is a 47-bp frameshift deletion in exon 1.
Last Known Status: Cryopreserved Sperm (as of 2017-01-13)
Rat AssemblyChrPosition (strand)SourceJBrowse
mRatBN7.21177,721,912 - 77,735,644RGD_MAPPER_PIPELINEmRatBN7.2
Rnor_6.01181,333,964 - 81,334,010RGD_MAPPER_PIPELINERnor6.0
Rnor_5.01184,363,940 - 84,382,663RGD_MAPPER_PIPELINERnor5.0
RGSC_v3.41179,908,291 - 79,911,065RGD_MAPPER_PIPELINERGSC3.4


References - curated
# Reference Title Reference Citation
1. Knockout rats via embryo microinjection of zinc-finger nucleases. Geurts AM, etal., Science. 2009 Jul 24;325(5939):433.
2. PhysGen Knockouts PhysGen Knockout strains
3. RGD Strain RSO annotation pipeline RGD Automated Pipelines


Allelic Variants
Name Chromosome Start Pos End Pos Reference Nucleotide Variant Nucleotide Variant Type Assembly
Adipoqem1Mcwi-var1 chr11 81333964 81334010 GTGACCAGGATATCCTGGGATGCCTGCCATCCAACCTGCACAAGTTT - deletion Rnor_6.0

Additional Information

Nomenclature History
Date Current Symbol Current Name Previous Symbol Previous Name Description Reference Status
2014-04-03 SS-Adipoqem1Mcwi    SS-Adipoqem1Mcwi    Name updated 68913 APPROVED
2014-04-03 SS-Adipoqem1Mcwi    SS-Adipoqem1Mcwi    Symbol updated 68687 APPROVED
2014-04-03 SS-Adipoqem1Mcwi    SS-Adipoqem1Mcwi    Name updated 68913 APPROVED
2014-04-03 SS-Adipoqem1Mcwi    SS-Adipoqem1Mcwi    Symbol updated 68687 APPROVED
2013-08-15 SS-Adipoqem1Mcwi    SS-Adipoqem1Mcwi    Name updated 68913 APPROVED