Strain Report - Rat Genome Database

Send us a Message



Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   

Strain: F344.AR-Ednrbsl/Hkv

Symbol: F344.AR-Ednrbsl/Hkv
Strain: F344-Ednrbsl
Substrain: Hkv
Full Name: Aganglionosis rat
RGD ID: 6480223
Citation ID: RRID:RGD_6480223
Ontology ID: RS:0003210
Alleles: Ednrbsl
Also Known As: F344-Ednrbsl; F344-Ednrbsl; F344-EdnrbslHkv; F344.AR-Ednrbsl/Hkv; NBRP Rat No: 0801; F344.AR-Ednrb^[sl]/Hkv
Type: mutant
Available Source: National BioResource Project for the Rat in Japan
Origination: Department of Disease Control, Graduate School of Veterinary Medicine, Hokkaido University, Hokkaido, Japan
Description: This strain derived from AR (aganglionosis) rat found by Dr. Ikadai in 1973. This congenic strain was established by backcrossing (over 10 generations) of AR rat to F344/NSlc.
Inbred Generations: N10
Last Known Status: Cryopreserved Embryo (as of 2016-10-28)
Position
Rat AssemblyChrPosition (strand)SourceJBrowse
mRatBN7.21580,670,748 - 80,671,048RGD_MAPPER_PIPELINEmRatBN7.2
Rnor_6.01588,034,987 - 88,035,287RGD_MAPPER_PIPELINERnor6.0
Rnor_5.01591,500,400 - 91,531,979RGD_MAPPER_PIPELINERnor5.0
RGSC_v3.41587,893,141 - 87,898,700RGD_MAPPER_PIPELINERGSC3.4





Disease Annotations     Click to see Annotation Detail View

Phenotype Annotations     Click to see Annotation Detail View

Mammalian Phenotype

Phenotype Values via PhenoMiner     Click to see Annotation Detail View
Options:  View chart  |  Download data table  |  View expanded data table


References

References - curated
# Reference Title Reference Citation
1. QTL analysis identifies a modifier locus of aganglionosis in the rat model of Hirschsprung disease carrying Ednrb(sl) mutations. Dang R, etal., PLoS One. 2011;6(11):e27902. Epub 2011 Nov 22.
2. Genetic background strongly modifies the severity of symptoms of Hirschsprung disease, but not hearing loss in rats carrying Ednrb(sl) mutations. Dang R, etal., PLoS One. 2011;6(9):e24086. Epub 2011 Sep 7.
3. Identification of genetic loci affecting the severity of symptoms of Hirschsprung disease in rats carrying Ednrbsl mutations by quantitative trait locus analysis. Huang J, etal., PLoS One. 2015 Mar 19;10(3):e0122068. doi: 10.1371/journal.pone.0122068. eCollection 2015.
4. Strains registered by the National Bio Resource Project for the Rat in Japan Personal Communication with NBRP
5. RGD Strain RSO annotation pipeline RGD Automated Pipelines

Region

Strain QTL Data
Symbol Name Trait
Gdil1 Gastrointestinal dilation QTL 1 enteric ganglion morphology trait   (VT:0001045)    
Allelic Variants
Name Chromosome Start Pos End Pos Reference Nucleotide Variant Nucleotide Variant Type Assembly
Ednrbsl-var1 chr15 80670748 80671048 CCCACCCCTGGTTTCCAGACCTGCAGATCACTATCAGGTACGTTACCTTGTAGGCATTAATGGGAATGTCGATGATGATGTGTAGCAGATCTCCCAGAGCCAGGCTGGCGATCAAGATATTGGGACCATTTCTCATGCACTTGTTCTTGTAGATGATTCTTAGCAGTGTGGAGTTCCCGATGATGCCTAGCACGAACACGAGGCATGATACAATCGTGTTGATGTATTTAAAAGTCTTGTTGATCTCAATTTTTCGTTGGCACGGAGGAGGGAAGGATCTTGGCGGGACTCCAGCCACCCT - deletion mRatBN7.2
Ednrbsl-var1 chr15 88034987 88035287 CCCACCCCTGGTTTCCAGACCTGCAGATCACTATCAGGTACGTTACCTTGTAGGCATTAATGGGAATGTCGATGATGATGTGTAGCAGATCTCCCAGAGCCAGGCTGGCGATCAAGATATTGGGACCATTTCTCATGCACTTGTTCTTGTAGATGATTCTTAGCAGTGTGGAGTTCCCGATGATGCCTAGCACGAACACGAGGCATGATACAATCGTGTTGATGTATTTAAAAGTCTTGTTGATCTCAATTTTTCGTTGGCACGGAGGAGGGAAGGATCTTGGCGGGACTCCAGCCACCCT - deletion Rnor_6.0

Additional Information

RGD Curation Notes
Note Type Note Reference
strain_characteristics Homozygous rats shows auditory disorder (congenital deafness). 40% of homozygous rats dies of megacolon and this mortality is lower than that of AGH rats (100%). Heterozygous (sl/+) rats don't show any phenotypes. 1302502
strain_reproduction all pups survived to weaning, almost 60% pups had no symptoms of aganglionosis 6480215
strain_reproduction maintained in heterozygous condition: A part of homozygous rats dies of megacolon. 1302502

Nomenclature History
Date Current Symbol Current Name Previous Symbol Previous Name Description Reference Status
2016-10-31 F344.AR-Ednrbsl/Hkv  Aganglionosis rat  F344.AR-EdnrbslHkv  Aganglionosis rat  Symbol updated 68687 APPROVED
2016-10-31 F344.AR-EdnrbslHkv  Aganglionosis rat  F344.AR-EdnrbSlHkv  Aganglionosis rat  Symbol updated 68687 APPROVED
2016-10-28 F344.AR-EdnrbSlHkv  Aganglionosis rat  F344-EdnrbSlHkv  Aganglionosis rat  Symbol updated 68687 APPROVED