Strain Report - Rat Genome Database

Send us a Message



Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   

Strain: AR-Ednrbsl/Hkv

Symbol: AR-Ednrbsl/Hkv
Strain: AR-Ednrbsl
Substrain: Hkv
Full Name: Aganglionosis rat
RGD ID: 6480218
Citation ID: RRID:RGD_6480218
Ontology ID: RS:0003208
Alleles: Ednrbsl
Previously known as: AGH/Hkv-Ednrbsl; AGH/Hkv-Ednrbsl; AGH-Ednrbsl; AR-Ednrbsl/Hkv
Type: mutant
Source: Department of Disease Control, Graduate School of Veterinary Medicine, Hokkaido University, Hokkaido, Japan
Origin: Congenital megacolon rats were found in offspring of a female albino rat crossed with a wild male by Ikadai et al. at Institute for Animal Reproduction in 1973 and were named Aganglionosis Rat (AR), provided to Dr. Takashi Agui by Dr. Ozaki, National Institute for Physiological Sciences, Okazaki, Japan
Last Known Status: Unknown
Position
Rat AssemblyChrPosition (strand)SourceJBrowse
mRatBN7.21580,640,839 - 80,672,115RGD_MAPPER_PIPELINEmRatBN7.2
Rnor_6.01588,004,775 - 88,036,354RGD_MAPPER_PIPELINERnor6.0
Rnor_5.01591,500,400 - 91,531,979RGD_MAPPER_PIPELINERnor5.0
RGSC_v3.41587,893,141 - 87,898,700RGD_MAPPER_PIPELINERGSC3.4

Congenic Strains
LE/Hkv.AR-Ednrbsl
Mutant Strains
LE/Hkv.AR-Ednrbsl




Disease Annotations     Click to see Annotation Detail View

Phenotype Annotations     Click to see Annotation Detail View

Phenotype Values via PhenoMiner     Click to see Annotation Detail View
Options:  View chart  |  Download data table  |  View expanded data table


References

References - curated
# Reference Title Reference Citation
1. Lymphopenia in Ednrb-deficient rat was strongly modified by genetic background. Dang R, etal., Biomed Res. 2012;33(4):249-53.
2. QTL analysis identifies a modifier locus of aganglionosis in the rat model of Hirschsprung disease carrying Ednrb(sl) mutations. Dang R, etal., PLoS One. 2011;6(11):e27902. Epub 2011 Nov 22.
3. Genetic background strongly modifies the severity of symptoms of Hirschsprung disease, but not hearing loss in rats carrying Ednrb(sl) mutations. Dang R, etal., PLoS One. 2011;6(9):e24086. Epub 2011 Sep 7.
4. Identification of genetic loci affecting the severity of symptoms of Hirschsprung disease in rats carrying Ednrbsl mutations by quantitative trait locus analysis. Huang J, etal., PLoS One. 2015 Mar 19;10(3):e0122068. doi: 10.1371/journal.pone.0122068. eCollection 2015.
5. QTL analysis of modifiers for pigmentary disorder in rats carrying Ednrb(sl) mutations. Huang J, etal., Sci Rep. 2016 Jan 22;6:19697. doi: 10.1038/srep19697.
6. RGD Strain RSO annotation pipeline RGD Automated Pipelines

Region

Strain QTL Data
Symbol Name Trait
Coatc10 Coat color QTL 10 coat/hair pigmentation trait   (VT:0010463)    
Coatc11 Coat color QTL 11 coat/hair pigmentation trait   (VT:0010463)    
Coatc12 Coat color QTL 12 coat/hair pigmentation trait   (VT:0010463)    
Coatc13 Coat color QTL 13 coat/hair pigmentation trait   (VT:0010463)    
Coatc14 Coat color QTL 14 coat/hair pigmentation trait   (VT:0010463)    
Coatc15 Coat color QTL 15 coat/hair pigmentation trait   (VT:0010463)    
Coatc16 Coat color QTL 16 coat/hair pigmentation trait   (VT:0010463)    
Coatc6 Coat color QTL 6 coat/hair pigmentation trait   (VT:0010463)    
Coatc7 Coat color QTL 7 coat/hair pigmentation trait   (VT:0010463)    
Coatc8 Coat color QTL 8 coat/hair pigmentation trait   (VT:0010463)    
Coatc9 Coat color QTL 9 coat/hair pigmentation trait   (VT:0010463)    
Gdil1 Gastrointestinal dilation QTL 1 enteric ganglion morphology trait   (VT:0001045)    
Gdil2 Gastrointestinal dilation QTL 2 enteric ganglion morphology trait   (VT:0001045)    
Allelic Variants
Name Chromosome Start Pos End Pos Reference Nucleotide Variant Nucleotide Variant Type Assembly
Ednrbsl-var1 chr15 80670748 80671048 CCCACCCCTGGTTTCCAGACCTGCAGATCACTATCAGGTACGTTACCTTGTAGGCATTAATGGGAATGTCGATGATGATGTGTAGCAGATCTCCCAGAGCCAGGCTGGCGATCAAGATATTGGGACCATTTCTCATGCACTTGTTCTTGTAGATGATTCTTAGCAGTGTGGAGTTCCCGATGATGCCTAGCACGAACACGAGGCATGATACAATCGTGTTGATGTATTTAAAAGTCTTGTTGATCTCAATTTTTCGTTGGCACGGAGGAGGGAAGGATCTTGGCGGGACTCCAGCCACCCT - deletion mRatBN7.2
Ednrbsl-var1 chr15 88034987 88035287 CCCACCCCTGGTTTCCAGACCTGCAGATCACTATCAGGTACGTTACCTTGTAGGCATTAATGGGAATGTCGATGATGATGTGTAGCAGATCTCCCAGAGCCAGGCTGGCGATCAAGATATTGGGACCATTTCTCATGCACTTGTTCTTGTAGATGATTCTTAGCAGTGTGGAGTTCCCGATGATGCCTAGCACGAACACGAGGCATGATACAATCGTGTTGATGTATTTAAAAGTCTTGTTGATCTCAATTTTTCGTTGGCACGGAGGAGGGAAGGATCTTGGCGGGACTCCAGCCACCCT - deletion Rnor_6.0

Additional Information

RGD Curation Notes
Note Type Note Reference
strain_anatomy abnormal dilation of the intestines due to absence of ganglion cells is observed in 14 days postnatal rats 6480215
strain_characteristics 301 bp deletion in Ednrb gene in exon 1 through intron 1 is responsible for these phenotypes 6480217
strain_reproduction 20% pups survived until weaning 6480215

Nomenclature History
Date Current Symbol Current Name Previous Symbol Previous Name Description Reference Status
2016-04-21 AR-Ednrbsl/Hkv  Aganglionosis rat  AR-EdnrbSl/Hkv  Aganglionosis rat  Symbol updated 68687 APPROVED
2015-10-23 AR-EdnrbSl/Hkv  Aganglionosis rat  AR-EdnrbSlHkv  Aganglionosis rat  Symbol updated 68687 APPROVED