Strain Report - Rat Genome Database

Send us a Message



Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   

Strain: SI-Tg(Ednrb)Ywa

Symbol: SI-Tg(Ednrb)Ywa
Strain: SI-Tg(Ednrb)
Substrain: Ywa
Full Name: transgenic spotting lethal
RGD ID: 629488
Citation ID: RRID:RGD_629488
Ontology ID: RS:0001577
Alleles: Ednrb;   Ednrbsl
Also Known As: DbH-EDNRB transgenic rat; DBH-ETB;ETBsl/sl; endothelin-B receptor-deficient rat; rescued sl
Type: transgenic
Available Source: Not Available
Origination: University of Texas Southwestern Medical Center, Dallas, Texas
Description: A 5.8 kb fragment of the human dopamine-beta-hydroxylase (DbH) promoter used directs rat Endrb expression in sl animals.
Last Known Status: Unknown





Disease Annotations     Click to see Annotation Detail View
hypertension  (IMP)

Phenotype Annotations     Click to see Annotation Detail View

Mammalian Phenotype

References

References - curated
# Reference Title Reference Citation
1. Transgenic expression of the endothelin-B receptor prevents congenital intestinal aganglionosis in a rat model of Hirschsprung disease. Gariepy CE, etal., J Clin Invest 1998 Sep 15;102(6):1092-101.
2. Salt-sensitive hypertension in endothelin-B receptor-deficient rats. Gariepy CE, etal., J Clin Invest 2000 Apr;105(7):925-33.
3. Exaggerated vascular and renal pathology in endothelin-B receptor-deficient rats with deoxycorticosterone acetate-salt hypertension. Matsumura Y, etal., Circulation 2000 Nov 28;102(22):2765-73.
4. Increased susceptibility to deoxycorticosterone acetate-salt-induced hypertension in endothelin-B-receptor-deficient rats. Matsumura Y, etal., J Cardiovasc Pharmacol. 2000 Nov;36(5 Suppl 1):S86-9.
5. RGD Strain RSO annotation pipeline RGD Automated Pipelines

Region

Allelic Variants
Name Chromosome Start Pos End Pos Reference Nucleotide Variant Nucleotide Variant Type Assembly
Ednrbsl-var1 chr15 80670748 80671048 CCCACCCCTGGTTTCCAGACCTGCAGATCACTATCAGGTACGTTACCTTGTAGGCATTAATGGGAATGTCGATGATGATGTGTAGCAGATCTCCCAGAGCCAGGCTGGCGATCAAGATATTGGGACCATTTCTCATGCACTTGTTCTTGTAGATGATTCTTAGCAGTGTGGAGTTCCCGATGATGCCTAGCACGAACACGAGGCATGATACAATCGTGTTGATGTATTTAAAAGTCTTGTTGATCTCAATTTTTCGTTGGCACGGAGGAGGGAAGGATCTTGGCGGGACTCCAGCCACCCT - deletion mRatBN7.2
Ednrbsl-var1 chr15 88034987 88035287 CCCACCCCTGGTTTCCAGACCTGCAGATCACTATCAGGTACGTTACCTTGTAGGCATTAATGGGAATGTCGATGATGATGTGTAGCAGATCTCCCAGAGCCAGGCTGGCGATCAAGATATTGGGACCATTTCTCATGCACTTGTTCTTGTAGATGATTCTTAGCAGTGTGGAGTTCCCGATGATGCCTAGCACGAACACGAGGCATGATACAATCGTGTTGATGTATTTAAAAGTCTTGTTGATCTCAATTTTTCGTTGGCACGGAGGAGGGAAGGATCTTGGCGGGACTCCAGCCACCCT - deletion Rnor_6.0

Additional Information

RGD Curation Notes
Note Type Note Reference
strain_characteristics Total RNA was extracted from the adrenal glands,lungs, kidneys, heart and brain of line 1 animals to confirm the expression. These had a much lower level of expression than the non-transgenic heterozygous animals 628516
strain_characteristics Total RNA was extracted from the adrenal glands,lungs, kidneys, heart and brain of line 1 animals to confirm the expression. These had a much lower level of expression than the non-transgenic heterozygous animals 628517
strain_drgs_chems Treatment of homozygous animals with deoxycorticosterone acetate (DOCA) salt resulted in higher systolic blood pressure than the wild type. When these animals were treated with ABT-627 an Enbra antagonist , it completely suppressed the hypertension 628516
strain_drgs_chems Treatment of homozygous animals with deoxycorticosterone acetate (DOCA) salt resulted in higher systolic blood pressure than the wild type. When these animals were treated with ABT-627 an Enbra antagonist , it completely suppressed the hypertension 628517
strain_drgs_chems Treatment of homozygous animals with deoxycorticosterone acetate (DOCA) salt resulted in higher systolic blood pressure than the wild type. When these animals were treated with ABT-627 an Enbra antagonist , it completely suppressed the hypertension  
strain_immunology Approximately 20% of hemizygous Sl/Sl rats and 5% of homozygous rats exhibit intestinal aganglionosis 628516
strain_immunology Approximately 20% of hemizygous Sl/Sl rats and 5% of homozygous rats exhibit intestinal aganglionosis 628517
strain_phys_biochem DbH-Endrb expression prevented intestinal aganglionosis when administered in the right dose 628516
strain_phys_biochem DbH-Endrb expression prevented intestinal aganglionosis when administered in the right dose 628517

Nomenclature History
Date Current Symbol Current Name Previous Symbol Previous Name Description Reference Status
2018-08-31 SI-Tg(Ednrb)Ywa  transgenic spotting lethal  SI-Tg(Ednrb)1Ywa  transgenic spotting lethal  Symbol updated 68687 APPROVED