Strain Report - Rat Genome Database

Send us a Message



Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   

Strain: SS-Mylipem2Mcwi

Symbol: SS-Mylipem2Mcwi
Strain: SS-Mylipem2
Substrain: Mcwi
RGD ID: 5509991
Citation ID: RRID:RGD_5509991
Ontology ID: RS:0003009
Alleles: Mylipem2Mcwi
Also Known As: SS-Mylipem2Mcwi; SS-Mylip^[em2Mcwi]
Type: mutant
Available Source: Not Available
Origination: PhysGen Knockouts
Description: This strain was produced by injecting ZFNs into SS/JrHsdMcwi rat embryos. The resulting mutation is a 49-bp deletion and one G insertion causing frameshift deletion in exon 1.
Last Known Status: Cryopreserved Sperm (as of 2017-01-26)
Position
Rat AssemblyChrPosition (strand)SourceJBrowse
mRatBN7.21719,308,054 - 19,308,102RGD_MAPPER_PIPELINEmRatBN7.2
Rnor_6.01719,682,040 - 19,703,681RGD_MAPPER_PIPELINERnor6.0
Rnor_5.01721,703,590 - 21,725,205RGD_MAPPER_PIPELINERnor5.0
RGSC_v3.41725,308,147 - 25,329,887RGD_MAPPER_PIPELINERGSC3.4






References

References - curated
# Reference Title Reference Citation
1. Knockout rats via embryo microinjection of zinc-finger nucleases. Geurts AM, etal., Science. 2009 Jul 24;325(5939):433.
2. PhysGen Knockouts PhysGen Knockout strains
3. RGD Strain RSO annotation pipeline RGD Automated Pipelines

Region

Allelic Variants
Name Chromosome Start Pos End Pos Reference Nucleotide Variant Nucleotide Variant Type Assembly
Mylipem2Mcwi-var1 chr17 19308054 19308102 TCACATAGCACAGCATGGCTGGGGCCGCCGCCACCGCCGCCACGGCCGC G delins mRatBN7.2

Additional Information


Nomenclature History
Date Current Symbol Current Name Previous Symbol Previous Name Description Reference Status
2014-03-26 SS-Mylipem2Mcwi    SS-Mylipem2Mcwi    Symbol updated 68687 APPROVED
2014-03-26 SS-Mylipem2Mcwi    SS-Mylipem2Mcwi    Symbol updated 68687 APPROVED
2014-03-26 SS-Mylipem2Mcwi    SS-Mylipem2Mcwi    Name updated 68913 APPROVED
2014-03-26 SS-Mylipem2Mcwi    SS-Mylipem2Mcwi    Name updated 68913 APPROVED
2013-08-15 SS-Mylipem2Mcwi    SS-Mylipem2Mcwi    Name updated 68913 APPROVED
2013-08-15 SS-Mylipem2Mcwi    SS-Mylipem2Mcwi    Name updated 68913 APPROVED