Strain Report - Rat Genome Database

Send us a Message



Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   

Strain: SS-Mthfrem1Mcwi

Symbol: SS-Mthfrem1Mcwi
Strain: SS-Mthfrem1
Substrain: Mcwi
RGD ID: 5131965
Citation ID: RRID:RGD_5131965
Ontology ID: RS:0002594
Alleles: Mthfrem1Mcwi
Also Known As: SS-Mthfrem1Mcwi; SS-Mthfr^[em1Mcwi]
Type: mutant
Available Source: Not Available
Origination: PhysGen Knockouts
Description: This strain was produced by injecting ZFNs targeting the sequence CCCCAGCCCCCGATCtgaggGCAGCAGCAGTGGCA into SS/JrHsdMcwi rat embryos. The resulting mutation is an 28-bp frameshift deletion in exon 2.
Last Known Status: Cryopreserved Sperm (as of 2017-01-26)
Position
Rat AssemblyChrPosition (strand)SourceJBrowse
mRatBN7.25158,467,728 - 158,467,755RGD_MAPPER_PIPELINEmRatBN7.2
Rnor_6.05164,844,642 - 164,864,360RGD_MAPPER_PIPELINERnor6.0
Rnor_5.05168,502,556 - 168,522,350RGD_MAPPER_PIPELINERnor5.0
RGSC_v3.45165,112,850 - 165,126,885RGD_MAPPER_PIPELINERGSC3.4






References

References - curated
# Reference Title Reference Citation
1. Identifying multiple causative genes at a single GWAS locus. Flister MJ, etal., Genome Res. 2013 Dec;23(12):1996-2002. doi: 10.1101/gr.160283.113. Epub 2013 Sep 4.
2. Knockout rats via embryo microinjection of zinc-finger nucleases. Geurts AM, etal., Science. 2009 Jul 24;325(5939):433.
3. PhysGen Knockouts PhysGen Knockout strains
4. RGD Strain RSO annotation pipeline RGD Automated Pipelines

Region

Allelic Variants
Name Chromosome Start Pos End Pos Reference Nucleotide Variant Nucleotide Variant Type Assembly
Mthfrem1Mcwi-var1 chr5 158467728 158467755 ATCTGAGGGCAGCAGCAGTGGCAGCGAG - deletion mRatBN7.2

Additional Information


Nomenclature History
Date Current Symbol Current Name Previous Symbol Previous Name Description Reference Status
2014-03-26 SS-Mthfrem1Mcwi    SS-Mthfrem1Mcwi    Symbol updated 68687 APPROVED
2014-03-26 SS-Mthfrem1Mcwi    SS-Mthfrem1Mcwi    Symbol updated 68687 APPROVED
2014-03-26 SS-Mthfrem1Mcwi    SS-Mthfrem1Mcwi    Name updated 68913 APPROVED
2014-03-26 SS-Mthfrem1Mcwi    SS-Mthfrem1Mcwi    Name updated 68913 APPROVED
2013-08-13 SS-Mthfrem1Mcwi    SS-Mthfrem1Mcwi    Name updated 68913 APPROVED
2013-08-13 SS-Mthfrem1Mcwi    SS-Mthfrem1Mcwi    Name updated 68913 APPROVED