Strain Report - Rat Genome Database

Send us a Message



Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   

Strain: SS-Nox4em1Mcwi

Symbol: SS-Nox4em1Mcwi
Strain: SS-Nox4em1
Substrain: Mcwi
RGD ID: 5131963
Citation ID: RRID:RGD_5131963
Ontology ID: RS:0002592
Alleles: Nox4em1Mcwi
Also Known As: SS-Nox4em1Mcwi; SS-Nox4^[em1Mcwi]
Type: mutant
Available Source: Not Available
Origination: PhysGen Knockouts
Description: This strain was produced by injecting ZFNs targeting the sequence ggttacagcttctacctatgcaataaggtaagggtc into SS/JrHsdMcwi rat embryos. The resulting mutation is a 5-bp frameshift deletion in exon 7.
Last Known Status: Cryopreserved Sperm (as of 2017-01-26)
Position
Rat AssemblyChrPosition (strand)SourceJBrowse
mRatBN7.21140,900,886 - 141,078,844RGD_MAPPER_PIPELINEmRatBN7.2
Rnor_6.01150,861,998 - 150,862,002RGD_MAPPER_PIPELINERnor6.0
Rnor_5.01157,106,652 - 157,285,107RGD_MAPPER_PIPELINERnor5.0
RGSC_v3.41143,415,816 - 143,603,554RGD_MAPPER_PIPELINERGSC3.4






References

References - curated
# Reference Title Reference Citation
1. Knockout rats via embryo microinjection of zinc-finger nucleases. Geurts AM, etal., Science. 2009 Jul 24;325(5939):433.
2. PhysGen Knockouts PhysGen Knockout strains
3. RGD Strain RSO annotation pipeline RGD Automated Pipelines

Region

Allelic Variants
Name Chromosome Start Pos End Pos Reference Nucleotide Variant Nucleotide Variant Type Assembly
Nox4em1Mcwi-var1 chr1 150861998 150862002 CTATG - deletion Rnor_6.0

Additional Information


Nomenclature History
Date Current Symbol Current Name Previous Symbol Previous Name Description Reference Status
2014-03-26 SS-Nox4em1Mcwi    SS-Nox4em1Mcwi    Name updated 68913 APPROVED
2014-03-26 SS-Nox4em1Mcwi    SS-Nox4em1Mcwi    Symbol updated 68687 APPROVED
2014-03-26 SS-Nox4em1Mcwi    SS-Nox4em1Mcwi    Name updated 68913 APPROVED
2014-03-26 SS-Nox4em1Mcwi    SS-Nox4em1Mcwi    Symbol updated 68687 APPROVED
2013-08-13 SS-Nox4em1Mcwi    SS-Nox4em1Mcwi    Name updated 68913 APPROVED