Strain Report - Rat Genome Database

Send us a Message



Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   

Strain: SS-Nox4em2Mcwi

Symbol: SS-Nox4em2Mcwi
Strain: SS-Nox4em2
Substrain: Mcwi
RGD ID: 4139883
Citation ID: RRID:RGD_4139883
Ontology ID: RS:0002437
Alleles: Nox4em2Mcwi
Previously known as: SS-Nox4em2Mcwi
Type: mutant
Source: PhysGen Knockouts
Origin: This strain was produced by injecting ZFNs targeting the sequence ggttacagcttctacctatgcaataaggtaagggtc into SS/JrHsdMcwi rat embryos. The resulting mutation is an 8-bp frameshift deletion in exon 7.
Last Known Status: Live Animals; Cryopreserved Sperm (as of 2017-01-26)
Position
Rat AssemblyChrPosition (strand)SourceJBrowse
mRatBN7.21140,900,886 - 141,078,844RGD_MAPPER_PIPELINEmRatBN7.2
Rnor_6.01150,796,359 - 150,976,186RGD_MAPPER_PIPELINERnor6.0
Rnor_5.01157,106,652 - 157,285,107RGD_MAPPER_PIPELINERnor5.0
RGSC_v3.41143,415,816 - 143,603,554RGD_MAPPER_PIPELINERGSC3.4






References

References - curated
# Reference Title Reference Citation
1. Knockout rats via embryo microinjection of zinc-finger nucleases. Geurts AM, etal., Science. 2009 Jul 24;325(5939):433.
2. PhysGen Knockouts PhysGen Knockout strains
3. RGD Strain RSO annotation pipeline RGD Automated Pipelines

Region


Additional Information


Nomenclature History
Date Current Symbol Current Name Previous Symbol Previous Name Description Reference Status
2014-03-25 SS-Nox4em2Mcwi    SS-Nox4em2Mcwi    Symbol updated 68687 APPROVED
2014-03-25 SS-Nox4em2Mcwi    SS-Nox4em2Mcwi    Name updated 68913 APPROVED
2014-03-25 SS-Nox4em2Mcwi    SS-Nox4em2Mcwi    Symbol updated 68687 APPROVED
2014-03-25 SS-Nox4em2Mcwi    SS-Nox4em2Mcwi    Name updated 68913 APPROVED