Strain Report - Rat Genome Database

Send us a Message



Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   

Strain: SS-Renem1Mcwi

Symbol: SS-Renem1Mcwi
Strain: SS-Renem1
Substrain: Mcwi
RGD ID: 4139880
Citation ID: RRID:RGD_4139880
Ontology ID: RS:0002434
Alleles: Renem1Mcwi
Also Known As: SS-Renem1Mcwi; SS-Ren^[em1Mcwi]
Type: mutant
Available Source: Not Available
Origination: PhysGen Knockouts
Description: This strain was produced by injecting ZFNs targeting the sequence acccttcatgctggccaagtttgacggggttctgggcatg into SS/JrHsdMcwi rat embryos. The resulting mutation is a 10-bp frameshift deletion in exon 5.
Last Known Status: Live Animals; Cryopreserved Sperm (as of 2017-01-26)
Position
Rat AssemblyChrPosition (strand)SourceJBrowse
mRatBN7.21344,803,412 - 44,803,421RGD_MAPPER_PIPELINEmRatBN7.2
Rnor_6.01350,502,724 - 50,513,953RGD_MAPPER_PIPELINERnor6.0
Rnor_5.01355,555,583 - 55,566,812RGD_MAPPER_PIPELINERnor5.0
RGSC_v3.41346,262,936 - 46,275,213RGD_MAPPER_PIPELINERGSC3.4






References

References - curated
# Reference Title Reference Citation
1. Knockout rats via embryo microinjection of zinc-finger nucleases. Geurts AM, etal., Science. 2009 Jul 24;325(5939):433.
2. PhysGen Knockouts PhysGen Knockout strains
3. RGD Strain RSO annotation pipeline RGD Automated Pipelines

Region

Allelic Variants
Name Chromosome Start Pos End Pos Reference Nucleotide Variant Nucleotide Variant Type Assembly
Renem1Mcwi-var1 chr13 44803412 44803421 GCCAAGTTTG - deletion mRatBN7.2

Additional Information


Nomenclature History
Date Current Symbol Current Name Previous Symbol Previous Name Description Reference Status
2014-03-25 SS-Renem1Mcwi    SS-Renem1Mcwi    Name updated 68913 APPROVED
2014-03-25 SS-Renem1Mcwi    SS-Renem1Mcwi    Symbol updated 68687 APPROVED
2014-03-25 SS-Renem1Mcwi    SS-Renem1Mcwi    Name updated 68913 APPROVED
2014-03-25 SS-Renem1Mcwi    SS-Renem1Mcwi    Symbol updated 68687 APPROVED
2013-08-13 SS-Renem1Mcwi    SS-Renem1Mcwi    Name updated 68913 APPROVED
2010-09-20 SS-Renem1Mcwi    SS-Renem2Mcwi    Symbol updated 68687 APPROVED
2010-09-20 SS-Renem1Mcwi    SS-Renem2Mcwi    Name updated 68913 APPROVED
2010-09-20 SS-Renem1Mcwi    SS-Renem2Mcwi    Symbol updated 68687 APPROVED
2010-09-20 SS-Renem1Mcwi    SS-Renem2Mcwi    Name updated 68913 APPROVED