Strain Report - Rat Genome Database

Send us a Message



Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   

Strain: SS-Mmp2em2Mcwi

Symbol: SS-Mmp2em2Mcwi
Strain: SS-Mmp2em2
Substrain: Mcwi
RGD ID: 4139878
Citation ID: RRID:RGD_4139878
Ontology ID: RS:0002432
Alleles: Mmp2em2Mcwi
Also Known As: SS-Mmp2em2Mcwi; SS-Mmp2^[em2Mcwi]
Type: mutant
Available Source: Not Available
Origination: PhysGen Knockouts
Description: This strain was produced by injecting ZFNs targeting the sequence aaccacaaccaactacgatgatgaccggaagtggggc into SS/JrHsdMcwi rat embryos. The resulting mutation is a 8-bp frameshift deletion in exon 7.
Last Known Status: Cryopreserved Sperm (as of 2021-11-03)
Position
Rat AssemblyChrPosition (strand)SourceJBrowse
mRatBN7.21914,154,657 - 14,182,870RGD_MAPPER_PIPELINEmRatBN7.2
Rnor_6.01915,542,771 - 15,570,589RGD_MAPPER_PIPELINERnor6.0
Rnor_5.01926,646,695 - 26,646,702RGD_MAPPER_PIPELINERnor5.0
RGSC_v3.41915,246,036 - 15,275,061RGD_MAPPER_PIPELINERGSC3.4






References

References - curated
# Reference Title Reference Citation
1. Knockout rats via embryo microinjection of zinc-finger nucleases. Geurts AM, etal., Science. 2009 Jul 24;325(5939):433.
2. Knockout of Matrix Metalloproteinase 2 Opposes Hypertension- and Diabetes-Induced Nephropathy. Hirata T, etal., J Cardiovasc Pharmacol. 2023 Aug 25. doi: 10.1097/FJC.0000000000001473.
3. PhysGen Knockouts PhysGen Knockout strains
4. RGD Strain RSO annotation pipeline RGD Automated Pipelines

Region

Allelic Variants
Name Chromosome Start Pos End Pos Reference Nucleotide Variant Nucleotide Variant Type Assembly
Mmp2em2Mcwi-var1 chr19 26646695 26646702 ATCATCGT - deletion Rnor_5.0

Additional Information


Nomenclature History
Date Current Symbol Current Name Previous Symbol Previous Name Description Reference Status
2014-03-25 SS-Mmp2em2Mcwi    SS-Mmp2em2Mcwi    Symbol updated 68687 APPROVED
2014-03-25 SS-Mmp2em2Mcwi    SS-Mmp2em2Mcwi    Symbol updated 68687 APPROVED
2014-03-25 SS-Mmp2em2Mcwi    SS-Mmp2em2Mcwi    Name updated 68913 APPROVED
2014-03-25 SS-Mmp2em2Mcwi    SS-Mmp2em2Mcwi    Name updated 68913 APPROVED
2013-08-13 SS-Mmp2em2Mcwi    SS-Mmp2em2Mcwi    Name updated 68913 APPROVED
2013-08-13 SS-Mmp2em2Mcwi    SS-Mmp2em2Mcwi    Name updated 68913 APPROVED