Strain Report - Rat Genome Database

Send us a Message



Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   

Strain: FHH.BN-(D1Hmgc14-D1Hmgc15)/Mcwi-Rab38em1Mcwi

Symbol: FHH.BN-(D1Hmgc14-D1Hmgc15)/Mcwi-Rab38em1Mcwi
Strain: FHH.BN-(D1Hmgc14-D1Hmgc15)/Mcwi-Rab38em1
Substrain: Mcwi
RGD ID: 4139877
Citation ID: RRID:RGD_4139877
Ontology ID: RS:0002431
Alleles: Rab38em1Mcwi
Also Known As: FHH.BN-Rab38em1Mcwi; FHH.BN1-Rab38-Rab38em1Mcwi; FHH.BN-(Rab38)Mcwi-Rab38em1Mcwi; FHH.BN-(D1Hmgc14-D1Hmgc15)Mcwi-Rab38em1Mcwi; FHH.BN-(D1Hmgc14-D1Hmgc15)/Mcwi-Rab38em1Mcwi; FHH.BN-(D1Hmgc14-D1Hmgc15)/Mcwi-Rab38^[em1Mcwi]
Type: mutant
Available Source: Not Available
Origination: PhysGen Knockouts
Description: This strain was produced by injecting ZFNs targeting the sequence CACCAAAACTTCTCCTCCCACTACCGGGCCACCATTGGT into FHH.BN-(D1Hmgc14-D1Hmgc15)/Mcwi rat embryos. The resulting mutation is a 1-bp frameshift deletion in exon 1.
Last Known Status: Cryopreserved Sperm (as of 2017-01-26)
Position
Rat AssemblyChrPosition (strand)SourceJBrowse
mRatBN7.21142,182,566 - 142,262,923RGD_MAPPER_PIPELINEmRatBN7.2
Rnor_6.01152,072,716 - 152,153,449RGD_MAPPER_PIPELINERnor6.0
Rnor_5.01158,385,888 - 158,466,621RGD_MAPPER_PIPELINERnor5.0
RGSC_v3.41144,783,919 - 144,864,573RGD_MAPPER_PIPELINERGSC3.4






References

References - curated
# Reference Title Reference Citation
1. Knockout rats via embryo microinjection of zinc-finger nucleases. Geurts AM, etal., Science. 2009 Jul 24;325(5939):433.
2. PhysGen Knockouts PhysGen Knockout strains
3. RGD Strain RSO annotation pipeline RGD Automated Pipelines

Region


Additional Information


Nomenclature History
Date Current Symbol Current Name Previous Symbol Previous Name Description Reference Status
2014-03-25 FHH.BN-(D1Hmgc14-D1Hmgc15)/Mcwi-Rab38em1Mcwi    FHH.BN-(D1Hmgc14-D1Hmgc15)/Mcwi-Rab38em1Mcwi    Symbol updated 68687 APPROVED
2014-03-25 FHH.BN-(D1Hmgc14-D1Hmgc15)/Mcwi-Rab38em1Mcwi    FHH.BN-(D1Hmgc14-D1Hmgc15)/Mcwi-Rab38em1Mcwi    Symbol updated 68687 APPROVED
2014-03-25 FHH.BN-(D1Hmgc14-D1Hmgc15)/Mcwi-Rab38em1Mcwi    FHH.BN-(D1Hmgc14-D1Hmgc15)/Mcwi-Rab38em1Mcwi    Name updated 68913 APPROVED
2014-03-25 FHH.BN-(D1Hmgc14-D1Hmgc15)/Mcwi-Rab38em1Mcwi    FHH.BN-(D1Hmgc14-D1Hmgc15)/Mcwi-Rab38em1Mcwi    Name updated 68913 APPROVED
2013-08-13 FHH.BN-(D1Hmgc14-D1Hmgc15)/Mcwi-Rab38em1Mcwi    FHH.BN-(D1Hmgc14-D1Hmgc15)/Mcwi-Rab38em1Mcwi    Name updated 68913 APPROVED
2012-02-17 FHH.BN-(D1Hmgc14-D1Hmgc15)/Mcwi-Rab38em1Mcwi    FHH.BN-(Rab38)/Mcwi-Rab38em1Mcwi    Name updated 68913 APPROVED
2012-02-17 FHH.BN-(D1Hmgc14-D1Hmgc15)/Mcwi-Rab38em1Mcwi    FHH.BN-(Rab38)/Mcwi-Rab38em1Mcwi    Name updated 68913 APPROVED
2012-02-17 FHH.BN-(Rab38)/Mcwi-Rab38em1Mcwi    FHH.BN-Rab38em1Mcwi    Symbol updated 68687 APPROVED
2012-02-17 FHH.BN-(Rab38)/Mcwi-Rab38em1Mcwi    FHH.BN-Rab38em1Mcwi    Name updated 68913 APPROVED
2012-02-17 FHH.BN-(Rab38)/Mcwi-Rab38em1Mcwi    FHH.BN-Rab38em1Mcwi    Symbol updated 68687 APPROVED
2012-02-17 FHH.BN-(Rab38)/Mcwi-Rab38em1Mcwi    FHH.BN-Rab38em1Mcwi    Name updated 68913 APPROVED
2012-02-17 FHH.BN-(D1Hmgc14-D1Hmgc15)/Mcwi-Rab38em1Mcwi    FHH.BN-(Rab38)/Mcwi-Rab38em1Mcwi    Symbol updated 68687 APPROVED
2012-02-17 FHH.BN-(Rab38)/Mcwi-Rab38em1Mcwi    FHH.BN-Rab38em1Mcwi    Name updated 68913 APPROVED
2012-02-17 FHH.BN-(Rab38)/Mcwi-Rab38em1Mcwi    FHH.BN-Rab38em1Mcwi    Symbol updated 68687 APPROVED
2012-02-17 FHH.BN-(Rab38)/Mcwi-Rab38em1Mcwi    FHH.BN-Rab38em1Mcwi    Name updated 68913 APPROVED
2012-02-17 FHH.BN-(Rab38)/Mcwi-Rab38em1Mcwi    FHH.BN-Rab38em1Mcwi    Symbol updated 68687 APPROVED
2012-02-17 FHH.BN-(D1Hmgc14-D1Hmgc15)/Mcwi-Rab38em1Mcwi    FHH.BN-(Rab38)/Mcwi-Rab38em1Mcwi    Symbol updated 68687 APPROVED
2011-05-16 FHH.BN-Rab38em1Mcwi    FHH.BN-Rab38em2Mcwi    Symbol updated 68687 APPROVED
2011-05-16 FHH.BN-Rab38em1Mcwi    FHH.BN-Rab38em2Mcwi    Name updated 68913 APPROVED
2011-05-16 FHH.BN-Rab38em1Mcwi    FHH.BN-Rab38em2Mcwi    Symbol updated 68687 APPROVED
2011-05-16 FHH.BN-Rab38em1Mcwi    FHH.BN-Rab38em2Mcwi    Name updated 68913 APPROVED