Strain Report - Rat Genome Database

Send us a Message



Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   

Strain: SS-Mmp2em1Mcwi

Symbol: SS-Mmp2em1Mcwi
Strain: SS-Mmp2em1
Substrain: Mcwi
RGD ID: 4139876
Citation ID: RRID:RGD_4139876
Ontology ID: RS:0002430
Alleles: Mmp2em1Mcwi
Also Known As: SS-Mmp2em1Mcwi; SS-Mmp2^[em1Mcwi]
Type: mutant
Available Source: Not Available
Origination: PhysGen Knockouts
Description: This strain was produced by injecting ZFNs targeting the sequence aaccacaaccaactacgatgatgaccggaagtggggc into SS/JrHsdMcwi rat embryos. The resulting mutation is a 10-bp frameshift deletion in exon 7.
Last Known Status: Extinct (as of 2017-01-26)
Position
Rat AssemblyChrPosition (strand)SourceJBrowse
mRatBN7.21914,154,657 - 14,182,870RGD_MAPPER_PIPELINEmRatBN7.2
Rnor_6.01915,542,771 - 15,570,589RGD_MAPPER_PIPELINERnor6.0
Rnor_5.01926,629,728 - 26,658,966RGD_MAPPER_PIPELINERnor5.0
RGSC_v3.41915,246,036 - 15,275,061RGD_MAPPER_PIPELINERGSC3.4






References

References - curated
# Reference Title Reference Citation
1. Knockout rats via embryo microinjection of zinc-finger nucleases. Geurts AM, etal., Science. 2009 Jul 24;325(5939):433.
2. Knockout of Matrix Metalloproteinase 2 Opposes Hypertension- and Diabetes-Induced Nephropathy. Hirata T, etal., J Cardiovasc Pharmacol. 2023 Aug 25. doi: 10.1097/FJC.0000000000001473.
3. PhysGen Knockouts PhysGen Knockout strains
4. RGD Strain RSO annotation pipeline RGD Automated Pipelines

Region


Additional Information


Nomenclature History
Date Current Symbol Current Name Previous Symbol Previous Name Description Reference Status
2014-03-25 SS-Mmp2em1Mcwi    SS-Mmp2em1Mcwi    Symbol updated 68687 APPROVED
2014-03-25 SS-Mmp2em1Mcwi    SS-Mmp2em1Mcwi    Name updated 68913 APPROVED
2014-03-25 SS-Mmp2em1Mcwi    SS-Mmp2em1Mcwi    Symbol updated 68687 APPROVED
2014-03-25 SS-Mmp2em1Mcwi    SS-Mmp2em1Mcwi    Name updated 68913 APPROVED