Strain Report - Rat Genome Database

Send us a Message



Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   

Strain: SS-Ets1em1Mcwi

Symbol: SS-Ets1em1Mcwi
Strain: SS-Ets1em1
Substrain: Mcwi
RGD ID: 4139874
Citation ID: RRID:RGD_4139874
Ontology ID: RS:0002428
Alleles: Ets1em1Mcwi
Also Known As: SS-Ets1em1Mcwi; SS-Ets1^[em1Mcwi]
Type: mutant
Available Source: Not Available
Origination: PhysGen Knockouts
Description: This strain was produced by injecting ZFNs targeting the sequence aacccatgtccgggattgggtgatgtgggctgtgaatgag into SS/JrHsdMcwi rat embryos. The resulting mutation is a 8-bp frameshift deletion in exon 3.
Last Known Status: Cryopreserved Sperm (as of 2017-01-26)
Position
Rat AssemblyChrPosition (strand)SourceJBrowse
mRatBN7.2831,045,909 - 31,168,010RGD_MAPPER_PIPELINEmRatBN7.2
Rnor_6.0833,851,478 - 33,851,485RGD_MAPPER_PIPELINERnor6.0
Rnor_5.0833,798,598 - 33,921,593RGD_MAPPER_PIPELINERnor5.0
RGSC_v3.4832,481,694 - 32,545,237RGD_MAPPER_PIPELINERGSC3.4






References

References - curated
# Reference Title Reference Citation
1. Avian erythroblastosis virus E26 oncogene homolog-1 (ETS-1) plays a role in renal microvascular pathophysiology in the Dahl salt-sensitive rat. Feng W, etal., Kidney Int. 2020 Mar;97(3):528-537. doi: 10.1016/j.kint.2019.09.025. Epub 2019 Oct 22.
2. Knockout rats via embryo microinjection of zinc-finger nucleases. Geurts AM, etal., Science. 2009 Jul 24;325(5939):433.
3. PhysGen Knockouts PhysGen Knockout strains
4. RGD Strain RSO annotation pipeline RGD Automated Pipelines

Region

Allelic Variants
Name Chromosome Start Pos End Pos Reference Nucleotide Variant Nucleotide Variant Type Assembly
Ets1em1Mcwi-var1 chr8 33851478 33851485 ATTGGGTG - deletion Rnor_6.0

Additional Information


Nomenclature History
Date Current Symbol Current Name Previous Symbol Previous Name Description Reference Status
2014-03-25 SS-Ets1em1Mcwi    SS-Ets1em1Mcwi    Symbol updated 68687 APPROVED
2014-03-25 SS-Ets1em1Mcwi    SS-Ets1em1Mcwi    Symbol updated 68687 APPROVED
2014-03-25 SS-Ets1em1Mcwi    SS-Ets1em1Mcwi    Name updated 68913 APPROVED
2014-03-25 SS-Ets1em1Mcwi    SS-Ets1em1Mcwi    Name updated 68913 APPROVED
2013-08-13 SS-Ets1em1Mcwi    SS-Ets1em1Mcwi    Name updated 68913 APPROVED
2013-08-13 SS-Ets1em1Mcwi    SS-Ets1em1Mcwi    Name updated 68913 APPROVED