Strain Report - Rat Genome Database

Send us a Message
Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   
Search RGD Grant Resources Citing RGD About Us Contact Us
Genes Variants Community Projects QTLs Strains Markers Genome Information Ontologies Cell Lines References Download Submit Data
OntoMate (Literature Search) JBrowse (Genome Browser) Synteny Browser (VCMap) Variant Visualizer Multi-Ontology Enrichment (MOET) Gene-Ortholog Location Finder (GOLF) InterViewer (Protein-Protein Interactions) PhenoMiner (Quatitative Phenotypes) Gene Annotator OLGA (Gene List Generator) AllianceMine GViewer (Genome Viewer)
Aging & Age-Related Disease Cancer & Neoplastic Disease Cardiovascular Disease Coronavirus Disease Developmental Disease Diabetes Hematologic Disease Immune & Inflammatory Disease Infectious Disease Liver Disease Neurological Disease Obesity & Metabolic Syndrome Renal Disease Respiratory Disease Sensory Organ Disease
Find Models Genetic Models Autism Models Rat PhenoMiner (Quantitative Phenotypes) Chinchilla PhenoMiner Expected Ranges (Quantitative Phenotype) PhenoMiner Term Comparison Hybrid Rat Diversity Panel Phenotypes Phenotypes in Other Animal Models Animal Husbandry Strain Medical Records Phylogenetics Strain Availability Calendar Rats 101 Submissions Photo Archive
Pathways
Rat Community Forum Directory of Rat Laboratories Video Tutorials News RGD Publications RGD Presentations Archive Nomenclature Guidelines Resource Links Laboratory Resources Employment Resources
Advanced Search (OLGA)
Strain Registration

Strain: SS-Del(1q)2Mcwi

Symbol: SS-Del(1q)2Mcwi
Strain: SS-Del(1q)2
Substrain: Mcwi
RGD ID: 404976873
Citation ID: RRID:RGD_404976873
Ontology ID: RS:0005332
Also Known As: SS-Del(1q)2Mcwi; SS-Del(1q)2/Mcwi; SS-Del(1q)2Mcwi
Type: mutant
Available Source: Please contact: mcwcustomrats@mcw.edu
Origination: Medical College of Wisconsin
Description: Four single guide RNAs and SpCas9 targeting sequences CTTCATTGTATGAGCAGCCG, TTTGAAAGAGACAGCTGCCT, ACGCACGTCGGACAGTTCCA, and GGCTTATTGCGCACGCACGT flanking a chromosome 1 region were targeted in SS/JrHsdMcwi embryos. An 82-bp deletion in chromosome 1 (rn7: chr1:255,749,164-255,749,245) resulted.
Genetic Status: Homozygous
Last Known Status: Cryopreserved Sperm (as of 2024-03-18)






References

References - curated
# Reference Title Reference Citation
1. Strains registration through online submission tool Strains registered through the Online Strain Submission Tool

Region


Additional Information


Nomenclature History
Date Current Symbol Current Name Previous Symbol Previous Name Description Reference Status
2024-05-17 SS-Del(1q)2Mcwi    SS-Del(1q)2/Mcwi    Symbol and/or name change 68913 APPROVED
2024-05-17 SS-Del(1q)2/Mcwi    SS-Del(1q)2Mcwi    Symbol and/or name change 68913 APPROVED
2024-03-18 SS-Del(1q)2Mcwi    SS-Del(1q)2Mcwi    Symbol and/or name change 68913 APPROVED