Strain Report - Rat Genome Database

Send us a Message



Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   

Strain: SD-Mpoem1Mcwi

Symbol: SD-Mpoem1Mcwi
Strain: SD-Mpoem1
Substrain: Mcwi
RGD ID: 401717572
Citation ID: RRID:RGD_401717572
Ontology ID: RS:0005294
Alleles: Mpoem1Mcwi
Also Known As: SD-Mpo em1Mcwi; SD-Mpo^[em1Mcwi]
Type: mutant
Available Source: Not Available
Origination: Medical College of Wisconsin
Description: CRISPR/SpCas9 system using sgRNA targeting the sequence CAGGGCCACGTGCAGATAGTCGG was used to introduce an 11-bp deletion (rn7: chr10:72,595,923-72,595,933) in exon 4 of the Mpo gene in Crl:SD strain rats.
Genetic Status: Heterozygous
Last Known Status: Live Animals (as of 2023-08-07)
Position
Rat AssemblyChrPosition (strand)SourceJBrowse
mRatBN7.21072,595,923 - 72,595,933RGD_MAPPER_PIPELINEmRatBN7.2
Rnor_6.01075,087,892 - 75,098,260RGD_MAPPER_PIPELINERnor6.0
Rnor_5.01075,004,128 - 75,014,496RGD_MAPPER_PIPELINERnor5.0
RGSC_v3.41076,085,872 - 76,097,012RGD_MAPPER_PIPELINERGSC3.4






References

References - curated
# Reference Title Reference Citation
1. Sleeve Gastrectomy Provides Cardioprotection from Oxidative Stress In Vitro Due to Reduction of Circulating Myeloperoxidase. Barron M, etal., Nutrients. 2023 Nov 14;15(22):4776. doi: 10.3390/nu15224776.
2. Strains registration through online submission tool Strains registered through the Online Strain Submission Tool

Region

Allelic Variants
Name Chromosome Start Pos End Pos Reference Nucleotide Variant Nucleotide Variant Type Assembly
Mpoem1Mcwi-var1 chr10 72595923 72595933 CTGCCGACTAT - deletion mRatBN7.2

Additional Information


Nomenclature History
Date Current Symbol Current Name Previous Symbol Previous Name Description Reference Status
2023-08-07 SD-Mpoem1Mcwi    SD-Mpo em1Mcwi    Symbol and/or name change 68913 APPROVED