Strain Report - Rat Genome Database

Send us a Message



Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   

Strain: W-Phf24em24Iexas

Symbol: W-Phf24em24Iexas
Strain: W-Phf24em24
Substrain: Iexas
RGD ID: 38676452
Citation ID: RRID:RGD_38676452
Ontology ID: RS:0004883
Also Known As: NBRP Rat No: 0888; Crlj:WI-Phf24 delta141; W-Phf24^[em24Iexas]
Type: mutant
Available Source: National BioResource Project for the Rat in Japan
Origination: National BioResource Project for the Rat in Japan
Description: This strain was establishe by CRISPR-Cas9 system at Osaka University. Target sequence is CCATGGGGGTGTTGATGTCCAAG (CCA is PAM sequence). Back ground strain is Crlj:Wistar (WI). This strain is line No. 24 and has a 141-bp deletion in Phf24 gene. Off-target effects (214 candidate region) have not yet been examined.
Coat Color: albino
Last Known Status: Cryopreserved Sperm (as of 2020-09-17)






References

References - curated
# Reference Title Reference Citation
1. Strains registered by the National Bio Resource Project for the Rat in Japan Personal Communication with NBRP

Region


Additional Information