Strain Report - Rat Genome Database

Send us a Message



Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   

Strain: WI-Tbc1d4em1Gdcz

Symbol: WI-Tbc1d4em1Gdcz
Strain: WI-Tbc1d4em1
RGD ID: 38596327
Citation ID: RRID:RGD_38596327
Ontology ID: RS:0004812
Alleles: Tbc1d4em1
Also Known As: WI-Tbc1d4em1; AS160-KO; WI-Tbc1d4^[em1Gdcz]
Type: mutant
Available Source: Not Available
Origination: Unit for Laboratory Animal Medicine, University of Michigan.
Description: The mutant rats were created with CRISPR/Cas9 system. A single guide RNA (sgRNA) and protospacer adjacent motif was designed targeting coding strand: 5' GCGACAAGCGCTTCCGGCTA TGG 3' with a predicted cut site 111 bp downstream of the initiation codon. Fertilized eggs, produced by mating superovulated Wistar female rats (Envigo Hsd:WI, Strain Code 001) with Wistar males, were microinjected with sgRNA and implanted to pseudopregnant rats. A founder line carrying a 20-bp substitution deletion (TGGCGACAAGCGTTCCGGC) was selected and backcrossed with wild type Wistar outbred rats (Charles River Laboratory; Wilmington, VA) to establish heterozygous (+/-) colony. No protein product was detected from knock out T homozygous mutant (-/-) .
Last Known Status: Unknown
Position
Rat AssemblyChrPosition (strand)SourceJBrowse
mRatBN7.21578,256,030 - 78,434,168RGD_MAPPER_PIPELINEmRatBN7.2
Rnor_6.01585,927,978 - 86,105,829RGD_MAPPER_PIPELINERnor6.0
Rnor_5.01589,695,614 - 89,871,879RGD_MAPPER_PIPELINERnor5.0
RGSC_v3.41585,359,159 - 85,561,229RGD_MAPPER_PIPELINERGSC3.4





Phenotype Annotations     Click to see Annotation Detail View

Mammalian Phenotype

References

References - curated
# Reference Title Reference Citation
1. Whole body glucoregulation and tissue-specific glucose uptake in a novel Akt substrate of 160 kDa knockout rat model. Arias EB, etal., PLoS One. 2019 Apr 29;14(4):e0216236. doi: 10.1371/journal.pone.0216236. eCollection 2019.
2. In vivo glucoregulation and tissue-specific glucose uptake in female Akt substrate 160 kDa knockout rats. Zheng X, etal., PLoS One. 2020 Feb 13;15(2):e0223340. doi: 10.1371/journal.pone.0223340. eCollection 2020.

Region


Additional Information


Nomenclature History
Date Current Symbol Current Name Previous Symbol Previous Name Description Reference Status
2020-09-14 WI-Tbc1d4em1Gdcz    WI-Tbc1d4em1    Symbol and/or name change 68913 APPROVED