Strain Report - Rat Genome Database

Send us a Message



 Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   
Search RGD Grant Resources Citing RGD About Us Contact Us
Genes Projects (beta) QTLs Strains Markers Genome Information Ontologies Cell Lines References Download Submit Data
OntoMate (Literature Search) JBrowse (Genome Browser) Synteny Browser (VCMap)  (beta) Variant Visualizer Multi-Ontology Enrichment (MOET) Gene-Ortholog Location Finder (GOLF) InterViewer (Protein-Protein Interactions) PhenoMiner (Quatitative Phenotypes) Gene Annotator OLGA (Gene List Generator) AllianceMine GViewer (Genome Viewer) Overgo Probe Designer
Aging & Age-Related Disease Cancer & Neoplastic Disease Cardiovascular Disease COVID-19 Developmental Disease Diabetes Hematologic Disease Immune & Inflammatory Disease Infectious Disease Liver Disease Neurological Disease Obesity & Metabolic Syndrome Renal Disease Respiratory Disease Sensory Organ Disease
Find Models   new Genetic Models Autism Models Rat PhenoMiner (Quantitative Phenotypes) Chinchilla PhenoMiner Expected Ranges (Quantitative Phenotype) PhenoMiner Term Comparison Hybrid Rat Diversity Panel Phenotypes GERRC (Gene Editing Rat Resource Center) Phenotypes in Other Animal Models Animal Husbandry Strain Medical Records Phylogenetics Strain Availability Calendar Rats 101 Submissions Photo Archive
Pathways
Rat Community Forum Directory of Rat Laboratories Video Tutorials News RGD Publications RGD Poster Archive Nomenclature Guidelines Resource Links Laboratory Resources Employment Resources
Strain Registration

Strain: LE.AR-Ednrbsl/Okkm

Symbol: LE.AR-Ednrbsl/Okkm
Strain: LE.AR-Ednrbsl
Substrain: Okkm
RGD ID: 2314375
Citation ID: RRID:RGD_2314375
Ontology ID: RS:0002042
Alleles: Ednrbsl;   Ednrb
Previously known as: LE.AR-Ednrbsl/Okkm;LE.AR-sl;NBRP Rat No: 0557; LE.AR-Ednrbsl/Okkm
Type: mutant
Source: National BioResource Project for the Rat in Japan
Origin: AR rats were found a by Ikadai et al. at Institute for Animal Reproduction in 1973. From 1997, backcross of AR rats onto Long Evans rats has started. After the 9th generation of backcrossing, it has been maintained by sib mating (F10 in May 2008).
Genetic Markers: Hooded
Inbred Generations: F10
Last Known Status: Cryopreserved Embryo (as of 2017-03-28)
Research Usage Internal Organ
Position
Rat AssemblyChrPosition (strand)SourceJBrowse
mRatBN7.21580,670,748 - 80,671,048RGD_MAPPER_PIPELINEmRatBN7.2
Rnor_6.01588,034,987 - 88,035,287RGD_MAPPER_PIPELINERnor6.0
Rnor_5.01591,500,400 - 91,531,979RGD_MAPPER_PIPELINERnor5.0
RGSC_v3.41587,893,141 - 87,898,700RGD_MAPPER_PIPELINERGSC3.4






References

References - curated
# Reference Title Reference Citation
1. Strains registered by the National Bio Resource Project for the Rat in Japan Personal Communication with NBRP
2. RGD Strain RSO annotation pipeline RGD Automated Pipelines

Region

Allelic Variants
Name Chromosome Start Pos End Pos Reference Nucleotide Variant Nucleotide Variant Type Assembly
Ednrbsl-var1 chr15 80670748 80671048 CCCACCCCTGGTTTCCAGACCTGCAGATCACTATCAGGTACGTTACCTTGTAGGCATTAATGGGAATGTCGATGATGATGTGTAGCAGATCTCCCAGAGCCAGGCTGGCGATCAAGATATTGGGACCATTTCTCATGCACTTGTTCTTGTAGATGATTCTTAGCAGTGTGGAGTTCCCGATGATGCCTAGCACGAACACGAGGCATGATACAATCGTGTTGATGTATTTAAAAGTCTTGTTGATCTCAATTTTTCGTTGGCACGGAGGAGGGAAGGATCTTGGCGGGACTCCAGCCACCCT - deletion mRatBN7.2
Ednrbsl-var1 chr15 88034987 88035287 CCCACCCCTGGTTTCCAGACCTGCAGATCACTATCAGGTACGTTACCTTGTAGGCATTAATGGGAATGTCGATGATGATGTGTAGCAGATCTCCCAGAGCCAGGCTGGCGATCAAGATATTGGGACCATTTCTCATGCACTTGTTCTTGTAGATGATTCTTAGCAGTGTGGAGTTCCCGATGATGCCTAGCACGAACACGAGGCATGATACAATCGTGTTGATGTATTTAAAAGTCTTGTTGATCTCAATTTTTCGTTGGCACGGAGGAGGGAAGGATCTTGGCGGGACTCCAGCCACCCT - deletion Rnor_6.0

Additional Information

RGD Curation Notes
Note Type Note Reference
strain_characteristics This congenic strain is characterized by megacolon and white coat color with a small pigmented spot on the head as shown in AR rat. This congenic strain usually dies within 1-5 weeks of age, but some individuals can survive, which suggest that a Long Evans gene might rescue their phenotype. 1302502
strain_reproduction Homozygous sl rats die within 1-5 weeks of age. The sl mutation is maintained in heterozygous condition (closed colony). 1302502

Nomenclature History
Date Current Symbol Current Name Previous Symbol Previous Name Description Reference Status
2016-04-21 LE.AR-Ednrbsl/Okkm    LE.AR-EdnrbSl/Okkm    Symbol updated 68687 APPROVED
2016-04-21 LE.AR-Ednrbsl/Okkm    LE.AR-EdnrbSl/Okkm    Symbol updated 68687 APPROVED
2016-04-21 LE.AR-Ednrbsl/Okkm    LE.AR-EdnrbSl/Okkm    Name updated 68913 APPROVED
2016-04-21 LE.AR-Ednrbsl/Okkm    LE.AR-EdnrbSl/Okkm    Name updated 68913 APPROVED
2012-05-29 LE.AR-EdnrbSl/Okkm    LE.AR-EdnrbSl/Okkm    Name updated 68913 APPROVED
2012-05-29 LE.AR-EdnrbSl/Okkm    LE.AR-EdnrbSl/Okkm    Name updated 68913 APPROVED