Strain Report - Rat Genome Database

Send us a Message



Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   

Strain: SD-Akt1em1Soar

Symbol: SD-Akt1em1Soar
Strain: SD-Akt1em1
Substrain: Soar
RGD ID: 158013766
Citation ID: RRID:RRRC_00891
Ontology ID: RS:0005258
Alleles: Akt1em1Soar
Also Known As: RRRC:00891; SD-Akt1^[em1Soar]
Type: mutant
Available Source: Not Available
Origination: Institute for Reproductive and Developmental Sciences, Department of Pathology & Laboratory Medicine, University of Kansas Medical Center, Kansas City, KS 66160, USA.
Description: This Akt mutant strain was created in zygotes from Holtzman Sprague-Dawley. Guided RNAs targeting exon 4 (target sequence: GCCGTTTGAGTCCATCAGCC; nucleotides 356-375) and exon 7 (target sequence: TTGTCATGGAGTACGCCAAT; nucleotides 712-731) of the Akt1 gene (NM_033230.3) were injected to the embryos to create a1332-bp deletion from exon 4 to exon7, resulting a premature stop of the protein.
Genetic Status: Homozygous
Last Known Status: Unknown
Position
Rat AssemblyChrPosition (strand)SourceJBrowse
mRatBN7.26131,717,680 - 131,719,011RGD_MAPPER_PIPELINEmRatBN7.2
Rnor_6.06137,218,398 - 137,239,970RGD_MAPPER_PIPELINERnor6.0
Rnor_5.06146,225,955 - 146,247,008RGD_MAPPER_PIPELINERnor5.0
RGSC_v3.46137,640,482 - 137,657,552RGD_MAPPER_PIPELINERGSC3.4






References

References - curated
# Reference Title Reference Citation
1. The AKT1-FOXO4 axis reciprocally regulates hemochorial placentation. Kozai K, etal., Development. 2023 Jan 15;150(2):dev201095. doi: 10.1242/dev.201095. Epub 2023 Jan 17.

Region

Allelic Variants
Name Chromosome Start Pos End Pos Reference Nucleotide Variant Nucleotide Variant Type Assembly
Akt1em1Soar-var1 chr6 131717680 131719011 GCGTACTCCATGACAAAGCAGAGGCGGTCGTGGGTCTGGAATGAGTACTTGAGGGCCTGAAATGGAAGCAGGGCAAGC CTAGGTAAGCACTGAGGAAGTAGCACACTGGCACTGCCCCCAGCCACCCCAAGATGTACCAGGGCACATTTTAGTGTC TTGAGATAGGTATCACCTTAGCTAAGGCTGGCCTGGACCTCAGGCGGCCCTGCCTAAAGGCAATAAGCCCAAACCGCT GGCCCTGGAACTCACCAGCTGCTGTCACTGAGCTGCACTCACAAGAAACCTGAGGGGTCTGCCTAGAAGACGGGTCTG AGGACTGAGGGCACGGAGAGTGGGGCAACTCAAGGCCTCAGCAGAGTGAGAAGACCAGACTCACGCCTCCCTCCTGTG CCCCACAGCGGTGGGTGGGCTTCCAGCCCACTCCGGCATCCCAGCCCCACCACCCCTATCAGTCCATGAAGCCCGTCT GTGTGGGTGCAGAGGCAGGCTGTGGGAGAGACACACTCGTCCCTATCCCACAGGGGTCAGACTGATAGTCACTACTTA CTGTAAGGAAGGGATGCCTAGAGTTCTGCAGGACACGGTTCTCAGTAAGCGTGTGGGCAACCTCATCCTGGAATGCAG AAGCCATGAGCACTTGTCCCCCACGTATCCCGTTCCTTCACCCTCCCTCCAACCCTGCACCCCCTGCACCTTGGCAAC GATGACCTCCTTCTTGAGGATCTTCATGGCATAGTAGCGACCTGTGGCCTTCTCCTTCACCAGGATCACCTTCCCAAA GGTGCCCTTGCCCAGTAGCTTCAGGTACTCAAACTCGTTCATGGTCTGTGGGTAGCAGAGAGAGCCCAGTTAGGGAGA GCCCTTGCTCACCACAACTAGCCTATGGCAATAAACACCTACACCACCACCTTCGGCTTGATAGTGTCCAGAGTGAAC AAGGCTCCTCCCAGTTAGCCAACAGTAAGAGCTAGACACAAGCCACGCCCGCTCTCACATCTGCTGGCCTGTGGGTCA GTGAGAGCACCGGGCCTTGGGAGTCGGTGGACACCTTCACTTTGCTTTCCTTAAGTACTGGGCTCTCGTGCATGCTAG ACAAGTACTCTGCCAACTCAGTCAGGTCAAGAGGAGCCAGGGGTCCCAGACCCACACAGGAAGCCAGGCAGGAACACC GGGACCTGCCGGGGCCCTCCACAGCCCTGGTAGCCCAGCAGAAGCGGAGGCCAGACTCACCACACGGTGCTTGGGCTT GGCCAGGGCCACCTCCATCTCCTCAGCACCTGAGTTGTCACTGGGTGAACCTGACCGGAAGTCCATCGTCTCCTCCTC CTGCCG - deletion mRatBN7.2

Additional Information

Database Acc Id Source(s)
RRRC RRRC:00891 RGD