Strain Report - Rat Genome Database

Send us a Message
Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   
Search RGD Grant Resources Citing RGD About Us Contact Us
Genes Variants Community Projects QTLs Strains Markers Genome Information Ontologies Cell Lines References Download Submit Data
OntoMate (Literature Search) JBrowse (Genome Browser) Synteny Browser (VCMap) Variant Visualizer Multi-Ontology Enrichment (MOET) Gene-Ortholog Location Finder (GOLF) InterViewer (Protein-Protein Interactions) PhenoMiner (Quatitative Phenotypes) Gene Annotator OLGA (Gene List Generator) AllianceMine GViewer (Genome Viewer)
Aging & Age-Related Disease Cancer & Neoplastic Disease Cardiovascular Disease Coronavirus Disease Developmental Disease Diabetes Hematologic Disease Immune & Inflammatory Disease Infectious Disease Liver Disease Neurological Disease Obesity & Metabolic Syndrome Renal Disease Respiratory Disease Sensory Organ Disease
Find Models Genetic Models Autism Models Rat PhenoMiner (Quantitative Phenotypes) Chinchilla PhenoMiner Expected Ranges (Quantitative Phenotype) PhenoMiner Term Comparison Hybrid Rat Diversity Panel Phenotypes Phenotypes in Other Animal Models Animal Husbandry Strain Medical Records Phylogenetics Strain Availability Calendar Rats 101 Submissions Photo Archive
Pathways
Rat Community Forum Directory of Rat Laboratories Video Tutorials News RGD Publications RGD Presentations Archive Nomenclature Guidelines Resource Links Laboratory Resources Employment Resources
Advanced Search (OLGA)
Strain Registration

Strain: SD-Abcc6em2Qlju+/-

Symbol: SD-Abcc6em2Qlju+/-
Strain: SD-Abcc6em2+/Abcc6em2-
Substrain: Qlju
RGD ID: 13792682
Citation ID: RRID:RGD_13792682
Ontology ID: RS:0004627
Alleles: Abcc6em2Qlju
Also Known As: SD-Abcc6^[em2Qlju+/-]
Type: mutant
Available Source: Not Available
Origination: Thomas Jefferson University, Philadelphia
Description: This strain was produced by injecting ZFNs into SD embryos. ZFNs were designed to target exon 1 of rat Abcc6 gene at the binding site/cutting site 5-CACGCCTGGAGAGTCCTGcgcaggCCTGAGGGTGAGTCC-3 (c.24-c.62). The resulting mutation is a 23 bp-deletion (TGCGCAGGCCTGAGGGTGAGTCC) from the first coding exon of the rat Abcc6 gene. The mutation is predicted to cause out of frame translation and a premature stop codon. No protein in the homozygous mutant was detected by immunostaining.
Genetic Status: Heterozygous
Last Known Status: Unknown
Position
Rat AssemblyChrPosition (strand)SourceJBrowse
mRatBN7.2196,447,224 - 96,501,464RGD_MAPPER_PIPELINEmRatBN7.2
Rnor_6.01101,954,786 - 102,013,252RGD_MAPPER_PIPELINERnor6.0
Rnor_5.01103,042,723 - 103,096,453RGD_MAPPER_PIPELINERnor5.0
RGSC_v3.4196,448,588 - 96,524,655RGD_MAPPER_PIPELINERGSC3.4





Phenotype Values via Phenominer Click to see Annotation Detail View
References

References - curated
# Reference Title Reference Citation
1. Abcc6 Knockout Rat Model Highlights the Role of Liver in PPi Homeostasis in Pseudoxanthoma Elasticum. Li Q, etal., J Invest Dermatol. 2017 May;137(5):1025-1032. doi: 10.1016/j.jid.2016.11.042. Epub 2017 Jan 19.

Region


Additional Information