Strain Report - Rat Genome Database

Send us a Message



Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   

Strain: SD-Esr1em1Soar

Symbol: SD-Esr1em1Soar
Strain: SD-Esr1em1
Substrain: Soar
RGD ID: 11667088
Citation ID: RRID:RRRC_00701
Ontology ID: RS:0004263
Alleles: Esr1em1Soar
Also Known As: Esr1-d482; SD-Esr1em1Soar; SD-Esr1^[em1Soar]
Type: mutant
Available Source: Rat Resource and Research Center
Origination: Rat Resource and Research Center
Description: zinc finger nucleases were used to generate a 482 bp deletion in Esr1 gene, resulting in a knock out.
Genetic Status: Heterozygous
Last Known Status: Cryopreserved Sperm (as of 2017-01-26)
Research Usage A range of experimentation examining the actions of estrogen in reproduction, cancer, cardiovascular, and neurobiology.
Position
Rat AssemblyChrPosition (strand)SourceJBrowse
mRatBN7.2141,272,347 - 41,272,828RGD_MAPPER_PIPELINEmRatBN7.2
Rnor_6.0141,358,808 - 41,359,289RGD_MAPPER_PIPELINERnor6.0
Rnor_5.0142,534,049 - 42,935,434RGD_MAPPER_PIPELINERnor5.0
RGSC_v3.4135,523,680 - 35,759,891RGD_MAPPER_PIPELINERGSC3.4





References

References - curated
# Reference Title Reference Citation
1. Generation of esr1-knockout rats using zinc finger nuclease-mediated genome editing. Rumi MA, etal., Endocrinology. 2014 May;155(5):1991-9. doi: 10.1210/en.2013-2150. Epub 2014 Feb 7.

Region

Allelic Variants
Name Chromosome Start Pos End Pos Reference Nucleotide Variant Nucleotide Variant Type Assembly
Esr1em1Soar-var1 chr1 41272347 41272828 GCTCAACTTTGTTTTGTTTTATGGATAATCCGCTGGAGTATGCGGTCCATTTCTTAAACAAGTTTGTAGAGAAAATCAATTTTTCTTCAAGGTTAATACAACAGGCAAACACCTTTTGCTGCATGTGTCAGAAAGAGACAATGAAAGATCATTGTGTAGATTATGAACCATTATTTCAAAATGTCAGAATAAAGTGGGTCTGCTGCATCCCCCCTGGTCTCACACTCTTCAGAGGGGAAAGAGGGCTTGCTTCTCAAATGCTAATGGATTTGCTTTCCCCCCTTCCTATCCCACCCCCAGGTCCAATTCTGACAATCGACGCCAGAATGGCCGAGAGAGACTCTCCAGCAGCAGCGAGAAGGGAAACATGATCATGGAGTCTGCCAAGGAGACTCGCTACTGTGCTGTGTGTAACGACTATGCCTCTGGCTACCATTATGGGGTCTGGTCCTGTGAAGGCTGCAAGGCTTTCTTTAAGAGAA - deletion mRatBN7.2
Esr1em1Soar-var1 chr1 41358808 41359289 GCTCAACTTTGTTTTGTTTTATGGATAATCCGCTGGAGTATGCGGTCCATTTCTTAAACAAGTTTGTAGAGAAAATCAATTTTTCTTCAAGGTTAATACAACAGGCAAACACCTTTTGCTGCATGTGTCAGAAAGAGACAATGAAAGATCATTGTGTAGATTATGAACCATTATTTCAAAATGTCAGAATAAAGTGGGTCTGCTGCATCCCCCCTGGTCTCACACTCTTCAGAGGGGAAAGAGGGCTTGCTTCTCAAATGCTAATGGATTTGCTTTCCCCCCTTCCTATCCCACCCCCAGGTCCAATTCTGACAATCGACGCCAGAATGGCCGAGAGAGACTCTCCAGCAGCAGCGAGAAGGGAAACATGATCATGGAGTCTGCCAAGGAGACTCGCTACTGTGCTGTGTGTAACGACTATGCCTCTGGCTACCATTATGGGGTCTGGTCCTGTGAAGGCTGCAAGGCTTTCTTTAAGAGAA - deletion Rnor_6.0

Additional Information


Nomenclature History
Date Current Symbol Current Name Previous Symbol Previous Name Description Reference Status
2017-06-23 SD-Esr1em1Soar    SD-ESR1em1Soar    Symbol updated 68687 APPROVED
2017-06-23 SD-Esr1em1Soar    SD-ESR1em1Soar    Symbol updated 68687 APPROVED

Database Acc Id Source(s)
RRRC RRRC:00701 RGD