Strain Report - Rat Genome Database

Send us a Message
Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   
Search RGD Grant Resources Citing RGD About Us Contact Us
Genes Variants Community Projects QTLs Strains Markers Genome Information Ontologies Cell Lines References Download Submit Data
OntoMate (Literature Search) JBrowse (Genome Browser) Synteny Browser (VCMap) Variant Visualizer Multi-Ontology Enrichment (MOET) Gene-Ortholog Location Finder (GOLF) InterViewer (Protein-Protein Interactions) PhenoMiner (Quatitative Phenotypes) Gene Annotator OLGA (Gene List Generator) AllianceMine GViewer (Genome Viewer)
Aging & Age-Related Disease Cancer & Neoplastic Disease Cardiovascular Disease Coronavirus Disease Developmental Disease Diabetes Hematologic Disease Immune & Inflammatory Disease Infectious Disease Liver Disease Neurological Disease Obesity & Metabolic Syndrome Renal Disease Respiratory Disease Sensory Organ Disease
Find Models Genetic Models Autism Models Rat PhenoMiner (Quantitative Phenotypes) Chinchilla PhenoMiner Expected Ranges (Quantitative Phenotype) PhenoMiner Term Comparison Hybrid Rat Diversity Panel Phenotypes Phenotypes in Other Animal Models Animal Husbandry Strain Medical Records Phylogenetics Strain Availability Calendar Rats 101 Submissions Photo Archive
Pathways
Rat Community Forum Directory of Rat Laboratories Video Tutorials News RGD Publications RGD Presentations Archive Nomenclature Guidelines Resource Links Laboratory Resources Employment Resources
Advanced Search (OLGA)
Strain Registration

Strain: SD-Fmr1em1Sage

Symbol: SD-Fmr1em1Sage
Strain: SD-Fmr1em1
Substrain: Sage
RGD ID: 11568040
Citation ID: RRID:RGD_11568040
Ontology ID: RS:0004275
Alleles: Fmr1em1Sage
Also Known As: TGRS5390; SD- Fmr1 tm1sage; SD-Fmr1em1Sage; Fmr1-Δexon 8 rat; SD-Fmr1^[em1Sage]
Type: mutant
Available Source: Horizon Discovery
Origination: Horizon Discovery
Description: The ZFN mutant rat strain was produced by injecting zinc finger nuclease targeting rat Fmr1 into Sprague Dawley embryos. The resulting mutation was a 122bp deletion of the intron 7/exon8 junction occurred at 18533bp-18654bp. This mutant rat has a knockout of Fmr1.
Genetic Status: Homozygous
Last Known Status: Live Animals (as of 2017-05-09)
Research Usage Autism, Fragile X syndrome
Position
Rat AssemblyChrPosition (strand)SourceJBrowse
GRCr8X152,284,857 - 152,322,686RGD_MAPPER_PIPELINE
mRatBN7.2X147,258,833 - 147,258,954RGD_MAPPER_PIPELINEmRatBN7.2
Rnor_6.0X154,703,661 - 154,703,782RGD_MAPPER_PIPELINERnor6.0
RGSC_v3.4X154,756,031 - 154,793,782RGD_MAPPER_PIPELINERGSC3.4





References

References - curated
# Reference Title Reference Citation
1. Experience-dependent changes in hippocampal spatial activity and hippocampal circuit function are disrupted in a rat model of Fragile X Syndrome. Asiminas A, etal., Mol Autism. 2022 Dec 20;13(1):49. doi: 10.1186/s13229-022-00528-z.
2. Auditory hypersensitivity and processing deficits in a rat model of fragile X syndrome. Auerbach BD, etal., Neurobiol Dis. 2021 Dec;161:105541. doi: 10.1016/j.nbd.2021.105541. Epub 2021 Oct 29.
3. Sensory hypo-excitability in a rat model of fetal development in Fragile X Syndrome. Berzhanskaya J, etal., Sci Rep. 2016 Jul 28;6:30769. doi: 10.1038/srep30769.
4. FMR1 deletion in rats induces hyperactivity with no changes in striatal dopamine transporter availability. D'Elia A, etal., Sci Rep. 2022 Dec 29;12(1):22535. doi: 10.1038/s41598-022-26986-2.
5. Deletion of the KH1 Domain of Fmr1 Leads to Transcriptional Alterations and Attentional Deficits in Rats. Golden CEM, etal., Cereb Cortex. 2019 May 1;29(5):2228-2244. doi: 10.1093/cercor/bhz029.
6. Fmr1 and Nlgn3 knockout rats: novel tools for investigating autism spectrum disorders. Hamilton SM, etal., Behav Neurosci. 2014 Apr;128(2):103-9. doi: 10.1037/a0035988.
7. Brain Cholesterol Biosynthetic Pathway Is Altered in a Preclinical Model of Fragile X Syndrome. Parente M, etal., Int J Mol Sci. 2022 Mar 21;23(6):3408. doi: 10.3390/ijms23063408.
8. Abnormal neuronal morphology and neurochemistry in the auditory brainstem of Fmr1 knockout rats. Ruby K, etal., Neuroscience. 2015 Sep 10;303:285-98. doi: 10.1016/j.neuroscience.2015.06.061. Epub 2015 Jul 9.

Region

Allelic Variants
Name Chromosome Start Pos End Pos Reference Nucleotide Variant Nucleotide Variant Type Assembly
Fmr1em1Sage-var1 chrX 147258833 147258954 CATGGCTGGCCTAAATGAAATTGACTTAATAATTGGTAAAACAAGTTAATCACTTGTGCATTTCTCTTCAGAGTTCAAGGCAGCTTGCCTCAAGATTTCATGAACAGTTTATCGTACGAGAA - deletion mRatBN7.2
Fmr1em1Sage-var1 chrX 154703661 154703782 CATGGCTGGCCTAAATGAAATTGACTTAATAATTGGTAAAACAAGTTAATCACTTGTGCATTTCTCTTCAGAGTTCAAGGCAGCTTGCCTCAAGATTTCATGAACAGTTTATCGTACGAGAA - deletion Rnor_6.0

Additional Information