Strain Report - Rat Genome Database

Send us a Message



Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   

Strain: SD-Mmp12em1Soar

Symbol: SD-Mmp12em1Soar
Strain: SD-Mmp12em1
Substrain: Soar
RGD ID: 11087553
Citation ID: RRID:RRRC_00770
Ontology ID: RS:0004197
Alleles: Mmp12em1Soar;   Mmp12
Also Known As: SD-Mmp12em1Soar; Mmp12-d663(E2); SD-Mmp12^[em1Soar]
Type: mutant
Available Source: Rat Resource and Research Center
Origination: Rat Resource and Research Center
Description: TALEN mediated 664 bp deletion that includes exon 2 of the Mmp12 gene, resulting in a frameshift and premature stop codon
Genetic Status: Heterozygous
Last Known Status: Cryopreserved Sperm; Cryorecovery (as of 2017-08-10)
Research Usage allergy and lung responses and blood coagulation
Position
Rat AssemblyChrPosition (strand)SourceJBrowse
mRatBN7.284,582,695 - 4,583,358RGD_MAPPER_PIPELINEmRatBN7.2
Rnor_6.085,607,502 - 5,608,165RGD_MAPPER_PIPELINERnor6.0
Rnor_5.085,610,392 - 5,620,294RGD_MAPPER_PIPELINERnor5.0
RGSC_v3.484,249,938 - 4,259,675RGD_MAPPER_PIPELINERGSC3.4





Phenotype Annotations     Click to see Annotation Detail View

Mammalian Phenotype

References

References - curated
# Reference Title Reference Citation
1. HIF-KDM3A-MMP12 regulatory circuit ensures trophoblast plasticity and placental adaptations to hypoxia. Chakraborty D, etal., Proc Natl Acad Sci U S A. 2016 Nov 15;113(46):E7212-E7221. Epub 2016 Nov 2.
2. Data registered by the Rat Resource & Research Center Personal Communication with Rat Resource & Research Center
3. RGD Strain RSO annotation pipeline RGD Automated Pipelines

Region

Allelic Variants
Name Chromosome Start Pos End Pos Reference Nucleotide Variant Nucleotide Variant Type Assembly
Mmp12em1Soar-var1 chr8 4582695 4583358 TTCCTCTGGAATTTTGGTAATCTGACTAATAATTTATAATGTTTTAAATAACATAGGAAGTTATTTTCTCCTCCTTGTAATAGACTCTCTAGGTAATAATAATAATGCAGCCTGTGATTAAAATACCTGGCTCAGGAACATCAGTATGCTACTGACCATGTTTGCAGGATTCCCAGCAGAAACCTGGCCGCATACAACTGTGTGCAATGCTTGTGTTTTGTCTAGTGGTACTTGTCAAGATTTTTTGACTATCAAGGGGACAGAATTCCAATGACAAAAACAAAAACCAATAGAAACCTCCTAGAAGAAAAACTCCAGGAAATGCAGCAGTTCTTTGGGCTAGAAGTAACTGGGCAACTGGACACCTCAACTCTGAAAATAATGCACACGTCTCGATGTGGAGTGCCTGATGTACAGCATCTTAGAGCAGTGCCCCAGAGGTCAAGATGGATGAAGCGGTATCTCACTTACAGGTAATGTCATTGGAGAACTCTTCTACTTGCCTATGAGTGTAGCCTCTAGAACCCTAGAACATTTAGCTACAACGAAATTCTAAATCCAAGAGTAGCCTCTGCAAATTGTTAATACAAATGTGTTCATTTTCTCCAGACTGGGTTGATGGCTCAGTGGAAAAAGCACTTGTCATACACTATAAGGGCCAGAG - deletion mRatBN7.2
Mmp12em1Soar-var1 chr8 5607502 5608165 TTCCTCTGGAATTTTGGTAATCTGACTAATAATTTATAATGTTTTAAATAACATAGGAAGTTATTTTCTCCTCCTTGTAATAGACTCTCTAGGTAATAATAATAATGCAGCCTGTGATTAAAATACCTGGCTCAGGAACATCAGTATGCTACTGACCATGTTTGCAGGATTCCCAGCAGAAACCTGGCCGCATACAACTGTGTGCAATGCTTGTGTTTTGTCTAGTGGTACTTGTCAAGATTTTTTGACTATCAAGGGGACAGAATTCCAATGACAAAAACAAAAACCAATAGAAACCTCCTAGAAGAAAAACTCCAGGAAATGCAGCAGTTCTTTGGGCTAGAAGTAACTGGGCAACTGGACACCTCAACTCTGAAAATAATGCACACGTCTCGATGTGGAGTGCCTGATGTACAGCATCTTAGAGCAGTGCCCCAGAGGTCAAGATGGATGAAGCGGTATCTCACTTACAGGTAATGTCATTGGAGAACTCTTCTACTTGCCTATGAGTGTAGCCTCTAGAACCCTAGAACATTTAGCTACAACGAAATTCTAAATCCAAGAGTAGCCTCTGCAAATTGTTAATACAAATGTGTTCATTTTCTCCAGACTGGGTTGATGGCTCAGTGGAAAAAGCACTTGTCATACACTATAAGGGCCAGAG - deletion Rnor_6.0

Additional Information

RGD Curation Notes
Note Type Note Reference
strain_life_disease Deficiency in Mmp12 and defects in hypoxia-activated uterine vascular remodeling during establishment of pregnancy 2292495
strain_other Investigating extracellular matrix remodeling, connections to allergy and lung responses and blood coagulation 2292495
Database Acc Id Source(s)
RRRC RRRC:00770 RGD