Strain Report - Rat Genome Database

Send us a Message



Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   
Pathways

Strain: SD-Abcc6em2Qlju-/-

Symbol: SD-Abcc6em2Qlju-/-
Strain: SD-Abcc6em2-/Abcc6em2-
Substrain: Qlju
RGD ID: 10413852
Citation ID: RRID:RGD_10413852
Ontology ID: RS:0004085
Alleles: Abcc6em2Qlju
Variant(s): Abcc6em2Qlju-var1
Also Known As: SD-Abcc6em2Qlju; SD-Abcc6^[em2Qlju-/-]
Type: mutant
Available Source: Not Available
Origination: Thomas Jefferson University, Philadelphia
Description: This strain was produced by injecting ZFNs into SD embryos. ZFNs were designed to target exon 1 of rat Abcc6 gene at the binding site/cutting site 5-CACGCCTGGAGAGTCCTGcgcaggCCTGAGGGTGAGTCC-3 (c.24-c.62). The resulting mutation is a 23 bp-deletion (TGCGCAGGCCTGAGGGTGAGTCC) from the first coding exon of the rat Abcc6 gene. The mutation is predicted to cause out of frame translation and a premature stop codon. No protein in the homozygous mutant was detected by immunostaining.
Genetic Status: Homozygous
Last Known Status: Unknown
Position
Rat AssemblyChrPosition (strand)SourceJBrowse
GRCr81105,637,763 - 105,637,785RGD_MAPPER_PIPELINE
mRatBN7.2196,501,332 - 96,501,354RGD_MAPPER_PIPELINEmRatBN7.2
Rnor_6.01102,013,111 - 102,013,133RGD_MAPPER_PIPELINERnor_6.0
Rnor_5.01103,042,723 - 103,096,453RGD_MAPPER_PIPELINERnor_5.0
RGSC_v3.4196,448,588 - 96,524,655RGD_MAPPER_PIPELINERGSC_v3.4





Disease Annotations     Click to see Annotation Detail View

Phenotype Annotations     Click to see Annotation Detail View

Mammalian Phenotype

References

References - curated
# Reference Title Reference Citation
1. Abcc6 Knockout Rat Model Highlights the Role of Liver in PPi Homeostasis in Pseudoxanthoma Elasticum. Li Q, etal., J Invest Dermatol. 2017 May;137(5):1025-1032. doi: 10.1016/j.jid.2016.11.042. Epub 2017 Jan 19.
2. Data registered by Dr. Qiaoli Li's group Personal communication between Dr. Qiaoli Li's group and the RGD curators.

Region

Allelic Variants
Name Chromosome Start Pos End Pos Reference Nucleotide Variant Nucleotide Variant Type Assembly
Abcc6em2Qlju-var1 chr1 105637763 105637785 GGACTCACCCTCAGGCCTGCGCA - deletion GRCr8
Abcc6em2Qlju-var1 chr1 96501332 96501354 GGACTCACCCTCAGGCCTGCGCA - deletion mRatBN7.2
Abcc6em2Qlju-var1 chr1 102013111 102013133 GGACTCACCCTCAGGCCTGCGCA - deletion Rnor_6.0

Additional Information


Nomenclature History
Date Current Symbol Current Name Previous Symbol Previous Name Description Reference Status
2018-09-19 SD-Abcc6em2Qlju-/-    SD-Abcc6em2Qlju    Symbol updated 68687 APPROVED
2018-09-19 SD-Abcc6em2Qlju-/-    SD-Abcc6em2Qlju    Symbol updated 68687 APPROVED