Strain Report - Rat Genome Database

Send us a Message



Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   

Strain: WI-Foxn1em1Nips

Symbol: WI-Foxn1em1Nips
Strain: WI-Foxn1em1
Substrain: Nips
RGD ID: 10053598
Citation ID: RRID:RGD_10053598
Ontology ID: RS:0003947
Alleles: Foxn1em1Nips
Previously known as: WI-Foxn1em1Nips
Type: mutant
Source: Section of Mammalian Transgenesis Center for Genetic Analysis of Behavior, National Institute for Physiological Sciences, Okazaki Aichi, JAPAN
Origin: Foxn1 mutation was induced by injecting pX330 espressing Cas9 and sgRNA targeting the sequence GACTGGAGGGCGAACCCCAA into Crlj:WI rat embryos. The resulting mutation is a 44-bp frameshift deletion in exon 1 (del 54-97).
Coat Color: Albino
Last Known Status: Unknown
Position
Rat AssemblyChrPosition (strand)SourceJBrowse
mRatBN7.21063,251,400 - 63,273,710RGD_MAPPER_PIPELINEmRatBN7.2
Rnor_6.01065,621,142 - 65,634,666RGD_MAPPER_PIPELINERnor6.0
Rnor_5.01066,004,940 - 66,030,134RGD_MAPPER_PIPELINERnor5.0
RGSC_v3.41064,243,323 - 64,256,847RGD_MAPPER_PIPELINERGSC3.4





Disease Annotations     Click to see Annotation Detail View


References

References - curated
# Reference Title Reference Citation
1. Hypomorphic phenotype of Foxn1 gene-modified rats by CRISPR/Cas9 system. Goto T, etal., Transgenic Res. 2016 Aug;25(4):533-44. doi: 10.1007/s11248-016-9941-9. Epub 2016 Mar 2.
2. Data registered by National Institute for Physiological Sciences, JAPAN Personal communication between Dr. Masumi Hirabayashi and RGD curators

Region


Additional Information

RGD Curation Notes
Note Type Note Reference
strain_characteristics thymus/T-cell-deficiency 7411635

Nomenclature History
Date Current Symbol Current Name Previous Symbol Previous Name Description Reference Status
2016-03-16 WI-Foxn1em1Nips    WI-Foxn1em1Nips    Symbol updated 68687 APPROVED
2016-03-16 WI-Foxn1em1Nips    WI-Foxn1em1Nips    Name updated 68913 APPROVED
2016-03-16 WI-Foxn1em1Nips    WI-Foxn1em1Nips    Symbol updated 68687 APPROVED
2016-03-16 WI-Foxn1em1Nips    WI-Foxn1em1Nips    Name updated 68913 APPROVED