Adipoqem1Mcwi-var1Rat Genome Database

Send us a Message



Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   

Variant: Adipoqem1Mcwi-var1 -  Rattus norvegicus

Name: Adipoqem1Mcwi-var1
RGD ID: 329969910
Description: Variant associated with allele Adipoqem1Mcwi; this allele was made by ZFN mutagenesis. The resulting mutation is a 47-bp frameshift deletion in exon 1 (del 186-232)
Type: deletion (SO:0000159)
Associated Allele:  Adipoqem1Mcwi
Reference Nucleotide: GTGACCAGGATATCCTGGGATGCCTGCCATCCAACCTGCACAAGTTT
Variant Nucleotide:
Position
Rat AssemblyChrPosition (strand)Source
Rnor_6.01181,333,964 - 81,334,010 (+)RGD




Related Rat Strains
The following Strains have been annotated to Adipoqem1Mcwi-var1


Additional Information