D5Mco57 Marker Search Result - Rat Genome Database

Send us a Message



Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   

Marker: D5Mco57

Symbol: D5Mco57
Previously known as:
RGD ID: 7777091
Type: SSLP
Expected Size: 236 (bp)
Position
Rat AssemblyChrPosition (strand)SourceJBrowse
Cytogenetic Map5 RGD
Is Marker For: Strains:   SS.LEW-(D5Mco39-D5Mco57)/2Mco   SS.LEW-(D5Mco39-D5Mco57)/1Mco   SS.LEW-(D5Mco39-D5Mco57)/3Mco  


Annotation


References - curated
# Reference Title Reference Citation
1. Isolation and high-throughput sequencing of two closely linked epistatic hypertension susceptibility loci with a panel of bicongenic strains. Pillai R, etal., Physiol Genomics. 2013 Aug 15;45(16):729-36. doi: 10.1152/physiolgenomics.00077.2013. Epub 2013 Jun 11.

Strains and Sequence

Sequence
 
Forward Primer CTTGCAGTTTGGACCCATTT
Reverse Primer GACATTTTCATTCCAAAGGGATA
 

Region

Nucleotide Sequences


Additional Information