D3Chm34 Marker Search Result - Rat Genome Database

Send us a Message



Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   

Marker: D3Chm34

Symbol: D3Chm34
Previously known as:
RGD ID: 728011
Expected Size: 155 (bp)
Position No map positions available.


Annotation


References - curated
# Reference Title Reference Citation
1. Quantitative trait loci with opposing blood pressure effects demonstrating epistasis on Dahl rat chromosome 3. Palijan A, etal., Physiol Genomics 2003 Sep 29;15(1):1-8.
2. UniSTS Pipeline RGD automated pipelines

Strains and Sequence

Sequence
 
Forward Primer GGCCAGCAAGAAAGATAAGG
Reverse Primer ACTCAGTGCGTGTGTTCCTG
 

Region



Additional Information

Database Acc Id Source(s)
UniSTS 265390 UniSTS