D3Chm2 Marker Search Result - Rat Genome Database

Send us a Message



Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   

Marker: D3Chm2

Symbol: D3Chm2
Previously known as:
RGD ID: 727997
Expected Size: 218 (bp)
Position
Rat AssemblyChrPosition (strand)SourceJBrowse
mRatBN7.233,712,411 - 3,712,633 (+)MAPPERmRatBN7.2
mRatBN7.233,345,441 - 3,345,663 (+)MAPPERmRatBN7.2
Rnor_6.02197,244,574 - 197,244,797NCBIRnor6.0
Rnor_6.02197,241,760 - 197,241,977NCBIRnor6.0
Rnor_5.02216,731,519 - 216,731,736UniSTSRnor5.0
RGSC_v3.43515,102 - 515,319UniSTSRGSC3.4
Celera8122,985,979 - 122,986,174UniSTS
Celera1882,315,385 - 82,315,653UniSTS
Cytogenetic Map3p13UniSTS
Is Marker For: Genes:   LOC679636  


Annotation


References - curated
# Reference Title Reference Citation
1. Quantitative trait loci with opposing blood pressure effects demonstrating epistasis on Dahl rat chromosome 3. Palijan A, etal., Physiol Genomics 2003 Sep 29;15(1):1-8.
2. UniSTS Pipeline RGD automated pipelines

Strains and Sequence

Sequence
 
Forward Primer CCCATTTACCAGTGAGAGCA
Reverse Primer CCAGATGCCCTTCAAGAGAG
 

Region

Genes in Region
The following Genes overlap with this region.    Full Report CSV TAB Printer Analysis Tools
RGD IDSymbolNameChrStartStopSpecies
11387673LOC108348230zinc finger protein 120-like333528803356833Rat
41010086Ube2v1-ps10ubiquitin conjugating enzyme E2 V1, pseudogene 10333718663373111Rat
41223310Nynrinl1NYN domain and retroviral integrase containing like 1333995213401354Rat
41279071LOC120101882uncharacterized LOC120101882334684883480630Rat
41095059LOC120101879uncharacterized LOC120101879335871943592561Rat
41302330Arhgap20-ps6rho GTPase activating protein 20, pseudogene 6335985613630812Rat
41180494Ube2v1-ps9ubiquitin conjugating enzyme E2 V1, pseudogene 9336600583660914Rat
41369322Ube2v1-ps17ubiquitin conjugating enzyme E2 V1, pseudogene 17336855223686366Rat

Nucleotide Sequences
GenBank Nucleotide CH474193.1 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  JH613764.1 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles


QTLs in Region (mRatBN7.2)
The following QTLs overlap with this region.    Full Report CSV TAB Printer Gviewer
RGD IDSymbolNameLODP ValueTraitSub TraitChrStartStopSpecies
70202Alc19Alcohol consumption QTL 192.5drinking behavior trait (VT:0001422)ethanol intake volume to total fluid intake volume ratio (CMO:0001591)3127494778Rat
631679Cm10Cardiac mass QTL 107.340.0001heart left ventricle mass (VT:0007031)heart left ventricle weight to body weight ratio (CMO:0000530)3131158234Rat
631831Alc8Alcohol consumption QTL 82.7consumption behavior trait (VT:0002069)calculated ethanol drink intake rate (CMO:0001615)3133230976Rat
61468Bp15Blood pressure QTL 154.4blood pressure trait (VT:0000183)diastolic blood pressure (CMO:0000005)3133278763Rat
61468Bp15Blood pressure QTL 154.4blood pressure trait (VT:0000183)systolic blood pressure (CMO:0000004)3133278763Rat
61468Bp15Blood pressure QTL 154.4blood pressure trait (VT:0000183)pulse pressure (CMO:0000292)3133278763Rat
631545Bp85Blood pressure QTL 853.1arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)3133278763Rat
4889966Bss95Bone structure and strength QTL 954.4tibia area (VT:1000281)tibia-fibula cross-sectional area (CMO:0001718)3136847613Rat
2312664Scl62Serum cholesterol level QTL 620.05blood cholesterol amount (VT:0000180)serum total cholesterol level (CMO:0000363)3138710544Rat
631568Bp92Blood pressure QTL 922.20.005arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)3139874793Rat
2290452Scl56Serum cholesterol level QTL 562.26blood cholesterol amount (VT:0000180)plasma total cholesterol level (CMO:0000585)3191609953Rat


Additional Information

Database Acc Id Source(s)
NCBI Gene 679636 UniSTS
UniSTS 265378 UniSTS