D3Chm32 Marker Search Result - Rat Genome Database

Send us a Message



Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   

Marker: D3Chm32

Symbol: D3Chm32
Previously known as:
RGD ID: 727996
Expected Size: 232 (bp)
Notes this SSLP was found to have more than 4 positions (total 18 positions) on the RGSC 5.0 genome assembly for UniSTS:265405; therefore these positions have been skipped during loading
Position No map positions available.


Annotation


References - curated
# Reference Title Reference Citation
1. Quantitative trait loci with opposing blood pressure effects demonstrating epistasis on Dahl rat chromosome 3. Palijan A, etal., Physiol Genomics 2003 Sep 29;15(1):1-8.
2. UniSTS Pipeline RGD automated pipelines

Strains and Sequence

Sequence
 
Forward Primer TCTGGAATCAGGTCCAAAGG
Reverse Primer CCTGCTTCTGCCTTCTGTTC
 

Region

Nucleotide Sequences
GenBank Nucleotide AU046852 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  CH474133.1 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  CH474148.1 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  CH474189.1 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  CH474220.1 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  CH474228.1 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  CH474248.1 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  CH474371.1 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  CH474519.1 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  DS030565.1 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  DS031558.1 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  JH612300.1 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  JH612319.1 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  JH612362.1 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  JH613602.1 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  JH614956.1 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  JH615907.1 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  JH616682.1 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  JH616929.1 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  JH617442.1 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  JH618582.1 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles


Additional Information

Database Acc Id Source(s)
UniSTS 265405 UniSTS