D7Uwm33 Marker Search Result - Rat Genome Database

Send us a Message



Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   

Marker: D7Uwm33

Symbol: D7Uwm33
Previously known as:
RGD ID: 7248570
Expected Size: 250 (bp)
Position
Rat AssemblyChrPosition (strand)SourceJBrowse
Cytogenetic Map7 RGD
Is Marker For: Strains:   ACI.BN-(D7Uwm33-D7Uwm43)/Shul   ACI.BN-(D7Rat164-D7Uwm33)/Shul   ACI.BN-(D7Uwm33-D7Mit27)/Shul   ACI.BN-(D7Uwm33-D7Uwm27)/Shul  


Annotation


References - curated
# Reference Title Reference Citation
1. Data registered by Dr. James D. Shull's group Personal communication between Dr. James D. Shull's group and the RGD curators

Strains and Sequence

Sequence
 
Forward Primer ACCCATCCAGACCCAGGTAG
Reverse Primer TGCAGTAAGCAAGGAAATGC
 
Strain Variation
Strain, Expected Size(s)
ACI/SegHsd275
BN/SsNHsd250


Region

Nucleotide Sequences


Additional Information