Myog Marker Search Result - Rat Genome Database

Send us a Message



Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   

Marker: Myog

Symbol: Myog
Also known as:
RGD ID: 7192896
Expected Size: 185 (bp)
Position
Rat AssemblyChrPosition (strand)SourceJBrowse
mRatBN7.21345,745,488 - 45,745,673 (+)MAPPER
Rnor_6.01351,126,493 - 51,126,677NCBIRnor6.0
Rnor_5.01356,182,781 - 56,182,965UniSTSRnor5.0
RGSC_v3.41347,243,746 - 47,243,930UniSTSRGSC3.4
Celera1346,073,606 - 46,073,790UniSTS
Cytogenetic Map13q13UniSTS
Is Marker For: Genes:   Myog  


Annotation


References - curated
1. RGD automated pipelines

Strains and Sequence

Sequence
 
Forward Primer TGGAGCTGTATGAGACATCCC
Reverse Primer TGGACAATGCTCAGGGGTCCC
 

Region



Additional Information

Database Acc Id Source(s)
NCBI Gene 29148 UniSTS
UniSTS 143982 UniSTS