Myog Marker Search Result - Rat Genome Database

Send us a Message



Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   

Marker: Myog

Symbol: Myog
Also known as:
RGD ID: 7192892
Expected Size: 114 (bp)
Position
Rat AssemblyChrPosition (strand)SourceJBrowse
mRatBN7.21345,747,899 - 45,748,013 (+)MAPPER
Rnor_6.01351,128,904 - 51,129,017NCBIRnor6.0
Rnor_5.01356,185,192 - 56,185,305UniSTSRnor5.0
RGSC_v3.41347,246,157 - 47,246,270UniSTSRGSC3.4
Celera1346,076,017 - 46,076,130UniSTS
Cytogenetic Map13q13UniSTS
Is Marker For: Genes:   Myog  


Annotation


References - curated
1. RGD automated pipelines

Strains and Sequence

Sequence
 
Forward Primer ACAGGCAGGGAAGGGGGTGGGGGCTCTTGG
Reverse Primer AAAGGAAATCCAAATAAGTTAGC
 

Region

Nucleotide Sequences


Additional Information

Database Acc Id Source(s)
NCBI Gene 29148 UniSTS
UniSTS 143981 UniSTS