D13Uwm5 Marker Search Result - Rat Genome Database

Send us a Message



Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   

Marker: D13Uwm5

Symbol: D13Uwm5
Previously known as: oxsts8340; UW283; 
RGD ID: 67816
Expected Size: 122 (bp)
Position
Rat AssemblyChrPosition (strand)SourceJBrowse
mRatBN7.2136,118,237 - 6,118,371 (+)MAPPERmRatBN7.2
Rnor_6.0139,169,524 - 9,169,657NCBIRnor6.0
Rnor_6.0139,135,540 - 9,135,673NCBIRnor6.0
Rnor_5.01314,435,482 - 14,435,615UniSTSRnor5.0
Rnor_5.01314,401,806 - 14,401,939UniSTSRnor5.0
RGSC_v3.41325,556,129 - 25,556,262UniSTSRGSC3.4
RGSC_v3.11325,558,952 - 25,559,086RGD
Celera137,054,168 - 7,054,301UniSTS
Cytogenetic Map13 RGD


Annotation


References - curated
# Reference Title Reference Citation
1. Data downloaded from Wellcome Trust, University of Oxford Data downloaded from Wellcome Trust, University of Oxford
2. Electronic Submission of SSLP Data Sets Gould M, Shepel L, Feb.(9) 2001. University of Wisconsin Medical School, McArdle Cancer Research Center
3. UniSTS Pipeline RGD automated pipelines

Strains and Sequence

Sequence
 
Forward Primer TTTTTACATATTCTTGTACTCA
Reverse Primer CAGAATTGGATGGCTAAGAC
 

Region

Nucleotide Sequences
GenBank Nucleotide AF045332 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  JH617720.1 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles


QTLs in Region (mRatBN7.2)
The following QTLs overlap with this region.    Full Report CSV TAB Printer Gviewer
RGD IDSymbolNameLODP ValueTraitSub TraitChrStartStopSpecies
2317027Aia22Adjuvant induced arthritis QTL 222.29joint integrity trait (VT:0010548)right rear ankle joint diameter (CMO:0002150)13134266636Rat
738036Lnnr4Liver neoplastic nodule remodeling QTL 43.64liver integrity trait (VT:0010547)liver remodeling tumorous lesion number (CMO:0001461)13142356786Rat
1354666Bp244Blood pressure QTL 2444.9arterial blood pressure trait (VT:2000000)diastolic blood pressure (CMO:0000005)131101056920Rat
1354666Bp244Blood pressure QTL 2444.9arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)131101056920Rat
1354666Bp244Blood pressure QTL 2444.9arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)131101056920Rat
631672Iddm12Insulin dependent diabetes mellitus QTL 122.20.0032blood glucose amount (VT:0000188)plasma glucose level (CMO:0000042)13599466834535351Rat
61339Bp24Blood pressure QTL 240.05arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)13599466844807491Rat
1581554Pur11Proteinuria QTL 11urine albumin amount (VT:0002871)urine albumin excretion rate (CMO:0000757)13599483377046787Rat
1581573Uae36Urinary albumin excretion QTL 36urine albumin amount (VT:0002871)urine albumin excretion rate (CMO:0000757)13599483377046787Rat


Additional Information

RGD Curation Notes
Note Type Note Reference
Database Acc Id Source(s)
NCBI Nucleotide AF045332
UniSTS 83254 UniSTS