D10Mco14 Marker Search Result - Rat Genome Database

Send us a Message



Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   

Marker: D10Mco14

Symbol: D10Mco14
Previously known as: oxsts4594; 
RGD ID: 66714
Expected Size: 130 (bp)
Position
Rat AssemblyChrPosition (strand)SourceJBrowse
Cytogenetic Map10 RGD
Is Marker For: Strains:   LEW.BN-(D10Mco17-D10Mco14)/Ciml   BN.LEW-(D10Mco17-D10Mco14)/Ciml  


Annotation


References - curated
# Reference Title Reference Citation
1. Data downloaded from Wellcome Trust, University of Oxford Data downloaded from Wellcome Trust, University of Oxford
2. Medical College of Ohio's SSLP Data file transfer Rapp J, Dene H,Direct Electronic Data transfer Feb.(5)2001 . Medical College of Ohio Department of Physiology and Molecular Medicine.
3. UniSTS Pipeline RGD automated pipelines

Strains and Sequence

Sequence
 
Forward Primer AAGTATGTGGTTGGTAAATG
Reverse Primer TGTGTATAGTGTGTAGTAAGTG
 

Region

Nucleotide Sequences
GenBank Nucleotide U53359 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles


Additional Information

RGD Curation Notes
Note Type Note Reference
Database Acc Id Source(s)
NCBI Nucleotide U53359
UniSTS 240191 UniSTS