D15Mco14 Marker Search Result - Rat Genome Database

Send us a Message
Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   
Search RGD Grant Resources Citing RGD About Us Contact Us
Genes Variants Community Projects QTLs Strains Markers Genome Information Ontologies Cell Lines References Download Submit Data
OntoMate (Literature Search) JBrowse (Genome Browser) Synteny Browser (VCMap) Variant Visualizer Multi-Ontology Enrichment (MOET) Gene-Ortholog Location Finder (GOLF) InterViewer (Protein-Protein Interactions) PhenoMiner (Quatitative Phenotypes) Gene Annotator OLGA (Gene List Generator) AllianceMine GViewer (Genome Viewer)
Aging & Age-Related Disease Behavioral & Substance Use Disorder Cancer & Neoplastic Disease Cardiovascular Disease Coronavirus Disease Developmental Disease Diabetes Hematologic Disease Immune & Inflammatory Disease Infectious Disease Liver Disease Neurological Disease Obesity & Metabolic Syndrome Renal Disease Respiratory Disease Sensory Organ Disease
Find Models Genetic Models Autism Models Rat PhenoMiner (Quantitative Phenotypes) Chinchilla PhenoMiner Expected Ranges (Quantitative Phenotype) PhenoMiner Term Comparison Hybrid Rat Diversity Panel Phenotypes Phenotypes in Other Animal Models Animal Husbandry Strain Medical Records Phylogenetics Strain Availability Calendar Rats 101 Submissions Photo Archive
Pathways
Rat Community Forum Directory of Rat Laboratories Video Tutorials News RGD Publications RGD Presentations Archive Nomenclature Guidelines Resource Links Laboratory Resources Employment Resources
Advanced Search (OLGA)

Marker: D15Mco14

Symbol: D15Mco14
Previously known as: oxsts8151; 
RGD ID: 66544
Expected Size: 176 (bp)
Position
Rat AssemblyChrPosition (strand)SourceJBrowse
GRCr81539,051,963 - 39,052,139 (+)Marker Load Pipeline
mRatBN7.21534,875,844 - 34,876,020 (+)MAPPERmRatBN7.2
Rnor_6.01541,035,266 - 41,035,441NCBIRnor6.0
Rnor_5.01544,847,381 - 44,847,556UniSTSRnor5.0
RGSC_v3.41539,820,949 - 39,821,125RGDRGSC3.4
RGSC_v3.41539,820,950 - 39,821,125UniSTSRGSC3.4
Celera1534,576,404 - 34,576,567UniSTS
RGSC_v3.11539,836,649 - 39,836,825RGD
Cytogenetic Map15p12UniSTS
Is Marker For: Genes:   Spata13  


Annotation


References - curated
# Reference Title Reference Citation
1. Data downloaded from Wellcome Trust, University of Oxford Data downloaded from Wellcome Trust, University of Oxford
2. Medical College of Ohio's SSLP Data file transfer Rapp J, Dene H,Direct Electronic Data transfer Feb.(5)2001 . Medical College of Ohio Department of Physiology and Molecular Medicine.
3. UniSTS Pipeline RGD automated pipelines

Strains and Sequence

Sequence
 
Forward Primer TAGTATCTGAAGATGACCCTG
Reverse Primer ACACCCAAGTTAAGGCTATGG
 

Region

Genes in Region
The following Genes overlap with this region.    Full Report CSV TAB Printer Analysis Tools
RGD IDSymbolNameChrStartStopSpecies
1307364Spata13spermatogenesis associated 13153895458539083752Rat

Nucleotide Sequences
GenBank Nucleotide AF052359 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles


QTLs in Region (GRCr8)
The following QTLs overlap with this region.    Full Report CSV TAB Printer Gviewer
RGD IDSymbolNameLODP ValueTraitSub TraitChrStartStopSpecies
1641913Colcr2Colorectal carcinoma resistance QTL 26.570.0197intestine integrity trait (VT:0010554)poorly differentiated malignant colorectal tumor number (CMO:0002076)15231575947315759Rat
5684946Bss98Bone structure and strength QTL 983.90.0026tibia strength trait (VT:1000284)tibia ultimate force (CMO:0001734)15139411584Rat
1641887Alcrsp14Alcohol response QTL 14response to alcohol trait (VT:0010489)brain neurotensin receptor 1 density (CMO:0002068)15144836456Rat
738017Hcas7Hepatocarcinoma susceptibility QTL 72.91liver integrity trait (VT:0010547)liver nonremodeling tumorous lesion volume to total liver volume ratio (CMO:0001464)15231575953331089Rat
152025253Hrtrt24Heart rate QTL 243.82heart pumping trait (VT:2000009)153185580392671517Rat
10755503Bp391Blood pressure QTL 3912.37arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)152272835342072050Rat
10054130Srcrt8Stress Responsive Cort QTL 82.180.0085blood corticosterone amount (VT:0005345)plasma corticosterone level (CMO:0001173)152852773273527732Rat
1578646Bmd18Bone mineral density QTL 185.2femur mineral mass (VT:0010011)trabecular volumetric bone mineral density (CMO:0001729)1525285835104695021Rat
2324620Coatc3Coat color QTL 3coat/hair pigmentation trait (VT:0010463)pigmented coat/hair area to total coat/hair area ratio (CMO:0001810)152233635152597086Rat
1578647Bmd17Bone mineral density QTL 174femur mineral mass (VT:0010011)total volumetric bone mineral density (CMO:0001728)1525285835104695021Rat
61424Scl1Serum cholesterol level QTL 17.70.001blood cholesterol amount (VT:0000180)serum total cholesterol level (CMO:0000363)151915576287086765Rat
10401805Kidm51Kidney mass QTL 51kidney mass (VT:0002707)both kidneys wet weight (CMO:0000085)15278592347785923Rat
2317750Glom26Glomerulus QTL 264.3urine protein amount (VT:0005160)urine protein level (CMO:0000591)151492659471614418Rat
631550Bw7Body weight QTL 73.6body mass (VT:0001259)body weight (CMO:0000012)152233635167336351Rat
1578660Bss19Bone structure and strength QTL 194.3femur morphology trait (VT:0000559)bone trabecular cross-sectional area (CMO:0002311)1525285835104695021Rat


Additional Information

Database Acc Id Source(s)
NCBI Gene 305938 UniSTS
NCBI Nucleotide AF052359