D10M11Mit84 Marker Search Result - Rat Genome Database

Send us a Message



Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   

Marker: D10M11Mit84

Symbol: D10M11Mit84
Previously known as:
RGD ID: 631291
Expected Size: 131 (bp)
Position
Rat AssemblyChrPosition (strand)SourceJBrowse
Cytogenetic Map10 RGD
Is Marker For: Strains:   SS.MNS-(Vamp2-D10M11Mit84)/Mco  
QTLs:   Bp250  


Annotation


References - curated
# Reference Title Reference Citation
1. Is the nitric oxide system involved in genetic hypertension in Dahl rats? Deng AY Kidney Int 1998 Jun;53(6):1501-11.
2. UniSTS Pipeline RGD automated pipelines

Strains and Sequence

Sequence
 
Forward Primer GCTGTGCCAAGAAACGTGTT
Reverse Primer ATATGGTTCACTTGTCCCGC
 

Region

Nucleotide Sequences


Additional Information

RGD Curation Notes
Note Type Note Reference
sslps_general primers sequences were obtained from MGI (MGI:702771); the expected size is for mouse genome 619625
Database Acc Id Source(s)
NCBI Gene 544609 UniSTS
UniSTS 126633 UniSTS