D10M11Mit119 Marker Search Result - Rat Genome Database

Send us a Message



Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   

Marker: D10M11Mit119

Symbol: D10M11Mit119
Previously known as:
RGD ID: 631289
Expected Size: 153 (bp)
Position
Rat AssemblyChrPosition (strand)SourceJBrowse
Cytogenetic Map10 RGD
Is Marker For: Strains:   SS.MNS-(D10Mit11-D10M11Mit119)/Mco   SS.LEW-(Nos2-D10M11Mit119)/Ayd   SS.MNS-(Aldoc-D10Mco1)/Jr   SS.LEW-(D10M11Mit119-D10Rat27)/Ayd  
QTLs:   Bp148   Bp91   Bp250  


Annotation


References - curated
# Reference Title Reference Citation
1. Construction of a double congenic strain to prove an epistatic interaction on blood pressure between rat chromosomes 2 and 10. Rapp JP, etal., J Clin Invest 1998 Apr 15;101(8):1591-5.
2. UniSTS Pipeline RGD automated pipelines

Strains and Sequence

Sequence
 
Forward Primer AAGCTTTTTCTATTTCAACCCTAA
Reverse Primer GTCTTTTACAGCCCTTTTTGTAGC
 

Region

Nucleotide Sequences


Additional Information

RGD Curation Notes
Note Type Note Reference
sslps_general primers sequences were obtained from MGI (MGI:701849); the expected size is for mouse genome  
Database Acc Id Source(s)
NCBI Gene 369136 UniSTS
  387442 UniSTS
  544609 UniSTS
UniSTS 126308 UniSTS