D1Uia4 Marker Search Result - Rat Genome Database

Send us a Message



 Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   
Search RGD Grant Resources Citing RGD About Us Contact Us
Genes QTLs Strains Markers Genome Information Ontologies Cell Lines References Download Submit Data
OntoMate (Literature Search) JBrowse (Genome Browser) Synteny Browser (VCMap)  (beta) Variant Visualizer Multi-Ontology Enrichment (MOET) Gene-Ortholog Location Finder (GOLF) InterViewer (Protein-Protein Interactions) PhenoMiner (Quatitative Phenotypes) Gene Annotator OLGA (Gene List Generator) AllianceMine GViewer (Genome Viewer) Overgo Probe Designer
Aging & Age-Related Disease Cancer & Neoplastic Disease Cardiovascular Disease COVID-19 Developmental Disease Diabetes Hematologic Disease Immune & Inflammatory Disease Infectious Disease Liver Disease Neurological Disease Obesity & Metabolic Syndrome Renal Disease Respiratory Disease Sensory Organ Disease
Find Models   new Genetic Models Autism Models Rat PhenoMiner (Quantitative Phenotypes) Chinchilla PhenoMiner Expected Ranges (Quantitative Phenotype) PhenoMiner Term Comparison Hybrid Rat Diversity Panel Phenotypes GERRC (Gene Editing Rat Resource Center) Phenotypes in Other Animal Models Animal Husbandry Strain Medical Records Phylogenetics Strain Availability Calendar Rats 101 Submissions Photo Archive
Pathways
Rat Community Forum Directory of Rat Laboratories Video Tutorials News RGD Publications RGD Poster Archive Nomenclature Guidelines Resource Links Laboratory Resources Employment Resources

Marker: D1Uia4

Symbol: D1Uia4
Previously known as: oxsts8544; 
RGD ID: 62475
Expected Size: 140 (bp)
Position
Rat AssemblyChrPosition (strand)SourceJBrowse
mRatBN7.2166,023,617 - 66,023,757 (+)MAPPERmRatBN7.2
mRatBN7.25146,042,096 - 146,042,138 (-)MAPPERmRatBN7.2
mRatBN7.21658,114,204 - 58,114,246 (-)MAPPERmRatBN7.2
mRatBN7.2917,435,338 - 17,435,380 (+)MAPPERmRatBN7.2
Rnor_6.0164,588,516 - 64,588,659NCBIRnor6.0
Rnor_5.0163,580,258 - 63,580,401UniSTSRnor5.0
RGSC_v3.4164,343,600 - 64,343,743UniSTSRGSC3.4
RGSC_v3.4164,343,599 - 64,343,742RGDRGSC3.4
RGSC_v3.1164,421,710 - 64,421,853RGD
Celera163,746,832 - 63,746,975UniSTS
Cytogenetic Map1 RGD
Is Marker For: Strains:   SS.LEW-(D1Uia4-D1Rat320)/Ayd  
QTLs:   Bp361  
Genes:   LOC100364635  


Annotation


References - curated
# Reference Title Reference Citation
1. Data downloaded from Wellcome Trust, University of Oxford Data downloaded from Wellcome Trust, University of Oxford
2. Medical College of Ohio's SSLP Data file transfer Rapp J, Dene H,Direct Electronic Data transfer Feb.(5)2001 . Medical College of Ohio Department of Physiology and Molecular Medicine.
3. UniSTS Pipeline RGD automated pipelines
4. Electronic SSLP Data Transfer Sheffield V, Direct Electronic Transfer of SSLP Dataset.2000 Oct;10.

Strains and Sequence

Sequence
 
Forward Primer ATCTGTAATGGGGATCCGAT
Reverse Primer GCTGGGAATCCAACCTATTT
 

Region

Genes in Region
The following Genes overlap with this region.    Full Report CSV TAB Printer Analysis Tools
RGD IDSymbolNameChrStartStopSpecies
1560151Ankrd66ankyrin repeat domain 6691742143217441212Rat
41116623LOC120094640uncharacterized LOC12009464091743427317459213Rat

Nucleotide Sequences
GenBank Nucleotide AF054130 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles


QTLs in Region (mRatBN7.2)
The following QTLs overlap with this region.    Full Report CSV TAB Printer Gviewer
RGD IDSymbolNameLODP ValueTraitSub TraitChrStartStopSpecies
1600378Arunc4Aerobic running capacity QTL 40.03exercise endurance trait (VT:0002332)maximum distance run on treadmill (CMO:0001406)1638024580345693Rat
2312660Bw95Body weight QTL 950.05inguinal fat pad mass (VT:0010424)inguinal fat pad weight to body weight ratio (CMO:0001253)1683223659492508Rat
2312663Slep9Serum leptin concentration QTL 90.001blood leptin amount (VT:0005667)serum leptin level (CMO:0000780)1683223659492508Rat
2312666Insul16Insulin level QTL 160.01blood insulin amount (VT:0001560)serum insulin level (CMO:0000358)1683223659492508Rat
2312669Stl23Serum triglyceride level QTL 230.01blood triglyceride amount (VT:0002644)serum triglyceride level (CMO:0000360)1683223659492508Rat
737826Alc11Alcohol consumption QTL 113.2consumption behavior trait (VT:0002069)ethanol drink intake rate (CMO:0001407)16422760960252231Rat
70205Gcr3Gastric cancer resistance QTL 32.3stomach morphology trait (VT:0000470)stomach tumor depth of invasion (CMO:0001888)161769679182635055Rat
70205Gcr3Gastric cancer resistance QTL 32.3stomach morphology trait (VT:0000470)stomach tumor depth of invasion (CMO:0001888)161769679182635055Rat
70205Gcr3Gastric cancer resistance QTL 32.3stomach morphology trait (VT:0000470)stomach tumor diameter (CMO:0001889)161769679182635055Rat
70205Gcr3Gastric cancer resistance QTL 32.3stomach morphology trait (VT:0000470)stomach tumor diameter (CMO:0001889)161769679182635055Rat
70215Niddm29Non-insulin dependent diabetes mellitus QTL 293.54blood glucose amount (VT:0000188)blood glucose level area under curve (AUC) (CMO:0000350)161900443575226532Rat
2302057Pia29Pristane induced arthritis QTL 293.60.001blood autoantibody amount (VT:0003725)serum immunoglobulin M-type rheumatoid factor level relative to an arbitrary reference serum (CMO:0002111)162173597566735975Rat
8694453Bw172Body weight QTL 1728.330.001retroperitoneal fat pad mass (VT:0010430)retroperitoneal fat pad weight to body weight ratio (CMO:0000635)162432551369325513Rat
6903294Stl30Serum triglyceride level QTL 302.60.0013blood triglyceride amount (VT:0002644)plasma triglyceride level (CMO:0000548)162515279370152793Rat
1298529Arunc1Aerobic running capacity QTL 14exercise endurance trait (VT:0002332)maximum distance run on treadmill (CMO:0001406)163195152060148445Rat
1578768Stresp22Stress response QTL 222.8thymus mass (VT:0004954)thymus wet weight (CMO:0000855)163528887080288870Rat
2293690Bss45Bone structure and strength QTL 455.130.0001lumbar vertebra morphology trait (VT:0010494)lumbar vertebra cortical cross-sectional area (CMO:0001690)163775215682752156Rat
2300163Bmd64Bone mineral density QTL 645.30.0001lumbar vertebra mineral mass (VT:0010511)volumetric bone mineral density (CMO:0001553)163775215682752156Rat
7205510Activ5Activity QTL 53.780.00028locomotor behavior trait (VT:0001392)number of entries into a discrete space in an experimental apparatus (CMO:0000960)164239634584729064Rat
8694429Bw164Body weight QTL 16450.001body lean mass (VT:0010483)lean tissue morphological measurement (CMO:0002184)165272646484729064Rat
8694364Abfw7Abdominal fat weight QTL 712.220.001visceral adipose mass (VT:0010063)abdominal fat pad weight to body weight ratio (CMO:0000095)165272646484729064Rat
7411648Foco22Food consumption QTL 22150.001eating behavior trait (VT:0001431)feed conversion ratio (CMO:0001312)165272646484729064Rat
631525Pia14Pristane induced arthritis QTL 144.4joint integrity trait (VT:0010548)joint inflammation composite score (CMO:0000919)165571108783402471Rat
7207486Bss109Bone structure and strength QTL 109femur strength trait (VT:0010010)femur total energy absorbed before break (CMO:0001677)5106906205151906205Rat
7207491Bss112Bone structure and strength QTL 1127femur morphology trait (VT:0000559)femur midshaft cortical cross-sectional area (CMO:0001663)5106906205151906205Rat
8694169Bw148Body weight QTL 14850.001body mass (VT:0001259)body weight gain (CMO:0000420)5128506074166875058Rat
1298089Scl14Serum cholesterol level QTL 145.80.0004blood cholesterol amount (VT:0000180)plasma total cholesterol level (CMO:0000585)5108845856153845856Rat
1549838Bss4Bone structure and strength QTL 49.2femur strength trait (VT:0010010)femur midshaft polar moment of inertia (CMO:0001669)5106906205151906205Rat
7207481Bss106Bone structure and strength QTL 1067.9femur strength trait (VT:0010010)femur ultimate force (CMO:0001675)5106906205151906205Rat
1578766Tcas11Tongue tumor susceptibility QTL 114.12tongue integrity trait (VT:0010553)number of squamous cell tumors of the tongue with diameter greater than 3 mm (CMO:0001950)546711509161317411Rat
1302790Scl20Serum cholesterol level QTL 206.40.0001blood cholesterol amount (VT:0000180)plasma total cholesterol level (CMO:0000585)582394392166664054Rat
1576314Eutr1Estrogen induced uterine response QTL 1uterus integrity trait (VT:0010575)pyometritis severity score (CMO:0002009)52138965166875058Rat
631562Apr2Acute phase response QTL 23.7blood murinoglobulin 1 amount (VT:0010597)plasma murinoglobulin 1 level (CMO:0001931)5135927956166875058Rat
1358187Emca1Estrogen-induced mammary cancer QTL 14.4mammary gland integrity trait (VT:0010552)post-insult time to mammary tumor formation (CMO:0000345)599216724148607142Rat
7207488Bss110Bone structure and strength QTL 18.4femur strength trait (VT:0010010)femur stiffness (CMO:0001674)5106906205151906205Rat
2293642Bss37Bone structure and strength QTL 374.640.0001femur strength trait (VT:0010010)femur ultimate force (CMO:0001675)5120740824151018848Rat
1549845Scl44Serum cholesterol level QTL 446blood cholesterol amount (VT:0000180)serum total cholesterol level (CMO:0000363)540128307148607290Rat
2302369Scl60Serum cholesterol level QTL 603.13blood cholesterol amount (VT:0000180)serum total cholesterol level (CMO:0000363)5143608201161165651Rat
8694389Bw160Body weight QTL 1606.170.001body lean mass (VT:0010483)lean tissue morphological measurement (CMO:0002184)5111416838156416838Rat
8694441Bw169Body weight QTL 16917.610.001retroperitoneal fat pad mass (VT:0010430)retroperitoneal fat pad weight to body weight ratio (CMO:0000635)5111416838156416838Rat
2317056Wbc3White blood cell count QTL 32.510.01leukocyte quantity (VT:0000217)white blood cell count (CMO:0000027)5105999803150999803Rat
10053720Scort26Serum corticosterone level QTL 262.060.0147blood corticosterone amount (VT:0005345)plasma corticosterone level (CMO:0001173)5124965598166875058Rat
8657050Bw146Body weight QTL 14619.840.001body mass (VT:0001259)body weight gain (CMO:0000420)5108938288153938288Rat
1578673Bmd13Bone mineral density QTL 134.9femur mineral mass (VT:0010011)trabecular volumetric bone mineral density (CMO:0001729)5103689353148689353Rat
8552908Pigfal4Plasma insulin-like growth factor 1 level QTL 46.6blood insulin-like growth factor amount (VT:0010479)plasma insulin-like growth factor 1 level (CMO:0001299)5128506074166875058Rat
61444Strs2Sensitivity to stroke QTL 24.7cerebrum integrity trait (VT:0010549)post-insult time to onset of cerebrovascular lesion (CMO:0002343)5135929696166875058Rat
631263Cm24Cardiac mass QTL 243.5heart mass (VT:0007028)heart left ventricle weight to body weight ratio (CMO:0000530)5143799107158428037Rat
1641920Colcs1Colorectal carcinoma susceptibility QTL 12.990.0055intestine integrity trait (VT:0010554)benign colorectal tumor surface area measurement (CMO:0001799)5121846814166846814Rat
8552960Pigfal15Plasma insulin-like growth factor 1 level QTL 15blood insulin-like growth factor amount (VT:0010479)plasma insulin-like growth factor 1 level (CMO:0001299)5111416838156416838Rat
1300119Bp180Blood pressure QTL 1803.82arterial blood pressure trait (VT:2000000)blood pressure time series experimental set point of the baroreceptor response (CMO:0002593)5144358090157869054Rat
1331721Bp210Blood pressure QTL 2103.413arterial blood pressure trait (VT:2000000)blood pressure time series experimental set point of the baroreceptor response (CMO:0002593)5143069996166846814Rat
631505Bp103Blood pressure QTL 1033.2arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)5132717196165560427Rat
61393Bp7Blood pressure QTL 74.50.0001arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)560293434161481680Rat
1354598Srn6Serum renin concentration QTL 63.8blood renin amount (VT:0003349)plasma renin activity level (CMO:0000116)569540295151018848Rat
634349Bp139Blood pressure QTL 1390.001arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)5128924607166875058Rat
70156Niddm30Non-insulin dependent diabetes mellitus QTL 303.98blood glucose amount (VT:0000188)blood glucose level area under curve (AUC) (CMO:0000350)5129132447151006154Rat
724525Bp147Blood pressure QTL 1474.30.0001arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)5126424772166875058Rat
1598819Bp292Blood pressure QTL 2924.3arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)5127798274166875058Rat
1598847Cm62Cardiac mass QTL 623.4heart mass (VT:0007028)heart weight to body weight ratio (CMO:0000074)5108845856153845856Rat
1598861Cm64Cardiac mass QTL 642.9heart mass (VT:0007028)heart weight to body weight ratio (CMO:0000074)5127798274166875058Rat
7794791Mcs33Mammary carcinoma susceptibility QTL 331.93mammary gland integrity trait (VT:0010552)mammary tumor incidence/prevalence measurement (CMO:0000946)5131345754166875058Rat
2313096Bmd78Bone mineral density QTL 783.10.0001tibia mineral mass (VT:1000283)total volumetric bone mineral density (CMO:0001728)5144377876161317411Rat
738018Anxrr4Anxiety related response QTL 45.1exploratory behavior trait (VT:0010471)percentage of entries into a discrete space in an experimental apparatus (CMO:0000961)5130130159166875058Rat
1331796Thshl2Thyroid stimulating hormone level QTL 22.3blood thyroid-stimulating hormone amount (VT:0005119)serum thyroid stimulating hormone level (CMO:0001248)597059760147465714Rat
8694198Abfw3Abdominal fat weight QTL 316.130.001visceral adipose mass (VT:0010063)abdominal fat pad weight to body weight ratio (CMO:0000095)5111416838156416838Rat
1554320Bmd1Bone mineral density QTL 112.20.0001femur mineral mass (VT:0010011)volumetric bone mineral density (CMO:0001553)150910886060548Rat
631688Hcas2Hepatocarcinoma susceptibility QTL 230.0001liver integrity trait (VT:0010547)liver tumorous lesion number (CMO:0001068)15925874115540829Rat
1300167Hrtrt2Heart rate QTL 24.35heart pumping trait (VT:2000009)heart rate (CMO:0000002)11148131275088344Rat
2313062Bmd73Bone mineral density QTL 733.90.0001tibia mineral mass (VT:1000283)compact volumetric bone mineral density (CMO:0001730)11148131282174945Rat
2313065Bss67Bone structure and strength QTL 673.10.0001tibia area (VT:1000281)tibia total energy absorbed before break (CMO:0001736)11148131282174945Rat
2313069Bss68Bone structure and strength QTL 682.90.0001tibia size trait (VT:0100001)tibia total energy absorbed before break (CMO:0001736)11148131282174945Rat
2313075Bss66Bone structure and strength QTL 663.40.0001tibia length (VT:0004357)tibia length (CMO:0000450)11148131282174945Rat
2313077Bss69Bone structure and strength QTL 693.50.0001tibia strength trait (VT:1000284)bone polar moment of inertia (CMO:0001558)11148131282174945Rat
2313092Bmd72Bone mineral density QTL 722.50.0001tibia mineral mass (VT:1000283)total volumetric bone mineral density (CMO:0001728)11148131282174945Rat
2313097Bss70Bone structure and strength QTL 703.50.0001tibia strength trait (VT:1000284)tibia total energy absorbed before break (CMO:0001736)11148131282174945Rat
1357400Bw62Body weight QTL624.05inguinal fat pad mass (VT:0010424)inguinal fat pad weight to body weight ratio (CMO:0001253)12234064767340647Rat
631495Bp96Blood pressure QTL 964.52arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)122340647102268831Rat
1331785Rf27Renal function QTL 274.643urine sodium amount (VT:0006274)urine sodium level (CMO:0000129)12887978078430678Rat
1358359Sradr1Stress Responsive Adrenal Weight QTL 14.74adrenal gland mass (VT:0010420)both adrenal glands wet weight (CMO:0000164)130882023123479925Rat
70225Bp58Blood pressure QTL 583.3arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)132356093162846471Rat
1300172Bp172Blood pressure QTL 1723.56arterial blood pressure trait (VT:2000000)diastolic blood pressure (CMO:0000005)13273727390665040Rat
10059597Bp377Blood pressure QTL 3773.420.025arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)132737458199368955Rat
1354599Bw29Body weight QTL 293.460.001body mass (VT:0001259)body weight (CMO:0000012)13344984878449848Rat
1354643Foco2Food consumption QTL 27.170.0001eating behavior trait (VT:0001431)food intake rate (CMO:0000427)13344984878449848Rat
8552900Pigfal1Plasma insulin-like growth factor 1 level QTL 17.4blood insulin-like growth factor amount (VT:0010479)plasma insulin-like growth factor 1 level (CMO:0001299)13483685879836858Rat
8552948Pigfal11Plasma insulin-like growth factor 1 level QTL 114.7blood insulin-like growth factor amount (VT:0010479)plasma insulin-like growth factor 1 level (CMO:0001299)13483685879836858Rat
9589820Insglur3Insulin/glucose ratio QTL 310.750.001blood insulin amount (VT:0001560)calculated plasma insulin level (CMO:0002170)13483685879836858Rat
1331732Srn4Serum renin concentration QTL 44.467renin activity (VT:0005581)plasma renin activity level (CMO:0000116)13523959878430678Rat
1331792Rf29Renal function QTL 294.589urine potassium amount (VT:0010539)urine potassium level (CMO:0000128)13523959878430678Rat
2313051Bss57Bone structure and strength QTL 573.70.0001tibia strength trait (VT:1000284)bone polar moment of inertia (CMO:0001558)143284731118944897Rat
2313059Bss55Bone structure and strength QTL 553.20.0001tibia size trait (VT:0100001)tibia midshaft cross-sectional area (CMO:0001717)143284731118944897Rat
2313072Bss53Bone structure and strength QTL 534.30.0001tibia length (VT:0004357)tibia length (CMO:0000450)143284731118944897Rat
2313078Bss54Bone structure and strength QTL 543.50.0001tibia area (VT:1000281)tibia midshaft cross-sectional area (CMO:0001717)143284731118944897Rat
2313094Bss58Bone structure and strength QTL 583.70.0001tibia strength trait (VT:1000284)tibia total energy absorbed before break (CMO:0001736)143284731118944897Rat
2313098Bmd70Bone mineral density QTL 703.60.0001tibia mineral mass (VT:1000283)compact volumetric bone mineral density (CMO:0001730)143284731118944897Rat
2313099Bss56Bone structure and strength QTL 562.40.0001tibia size trait (VT:0100001)tibia midshaft endosteal cross-sectional area (CMO:0001716)143284731118944897Rat
2302059Pia36Pristane induced arthritis QTL 363.80.001blood immunoglobulin amount (VT:0002460)serum immunoglobulin G1 level (CMO:0002115)14333300288333002Rat
1331778Rf28Renal function QTL 284.66urine potassium amount (VT:0010539)urine potassium excretion rate (CMO:0000761)14580314078430678Rat
2313402Anxrr24Anxiety related response QTL 24aggression-related behavior trait (VT:0015014)tameness/aggressiveness composite score (CMO:0002136)148963584144267916Rat
4889962Bss94Bone structure and strength QTL 943.8tibia area (VT:1000281)tibia-fibula cortical bone endosteal cross-sectional area (CMO:0001722)14936146582174945Rat
1578649Bmd8Bone mineral density QTL 84.9femur mineral mass (VT:0010011)trabecular volumetric bone mineral density (CMO:0001729)14939317294393172Rat
1578654Bss10Bone structure and strength QTL 104femur morphology trait (VT:0000559)femoral neck cortical cross-sectional area (CMO:0001702)149393172159356837Rat
634314Niddm44Non-insulin dependent diabetes mellitus QTL 44blood glucose amount (VT:0000188)blood glucose level (CMO:0000046)149393289199050459Rat
6903308Scl36Serum cholesterol QTL 3620.0125blood cholesterol amount (VT:0000180)plasma total cholesterol level (CMO:0000585)15386304190532583Rat
4889919Bss86Bone structure and strength QTL 864.1tibia area (VT:1000281)tibia midshaft total cross-sectional area (CMO:0001715)15389511782174945Rat
4889929Bss87Bone structure and strength QTL 876.7tibia area (VT:1000281)tibia-fibula cortical bone endosteal cross-sectional area (CMO:0001722)15389511782174945Rat
61342Bp27Blood pressure QTL 273.40.0006arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)15673266898773277Rat
2300164Bmd44Bone mineral density QTL 445.40.0001lumbar vertebra mineral mass (VT:0010511)volumetric bone mineral density (CMO:0001553)156949932101949932Rat
2298545Neuinf8Neuroinflammation QTL 84.6nervous system integrity trait (VT:0010566)spinal cord beta-2 microglobulin mRNA level (CMO:0002125)157336763151090257Rat
1300121Hrtrt1Heart rate QTL 13.7heart pumping trait (VT:2000009)heart rate (CMO:0000002)165789093115540829Rat
7421628Bp361Blood pressure QTL 3610.001arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)166023617118608521Rat
70226Eae4Experimental allergic encephalomyelitis QTL 4nervous system integrity trait (VT:0010566)experimental autoimmune encephalomyelitis incidence/prevalence measurement (CMO:0001046)9125661317Rat
9589055Scfw5Subcutaneous fat weight QTL 55.550.001subcutaneous adipose mass (VT:1000472)abdominal subcutaneous fat pad weight (CMO:0002069)9137999212Rat
7411592Foco8Food consumption QTL 87.40.001eating behavior trait (VT:0001431)feed conversion ratio (CMO:0001312)9137999212Rat
9589158Gluco65Glucose level QTL 656.820.001blood glucose amount (VT:0000188)plasma glucose level (CMO:0000042)9137999212Rat
1300124Cm4Cardiac mass QTL 43.55heart mass (VT:0007028)heart weight to body weight ratio (CMO:0000074)9140594091Rat
1298088Edpm11Estrogen-dependent pituitary mass QTL 112.5pituitary gland mass (VT:0010496)pituitary gland wet weight (CMO:0000853)9143718459Rat
1641911Alcrsp13Alcohol response QTL 13response to alcohol trait (VT:0010489)brain neurotensin receptor 1 density (CMO:0002068)9143718459Rat
10054125Srcrt7Stress Responsive Cort QTL 73.330.0011blood corticosterone amount (VT:0005345)plasma corticosterone level (CMO:0001173)9187073594Rat
1331757Cdexp1CD45RC expression in CD8 T cells QTL 14.3CD8-positive T cell quantity (VT:0008077)blood CD45RC(high) CD8 T cell count to CD45RC(low) CD8 T cell count ratio (CMO:0001990)9102453767509080Rat
1354650Despr5Despair related QTL 54.010.0017locomotor behavior trait (VT:0001392)amount of time spent in voluntary immobility (CMO:0001043)9125408446254084Rat
2303559Gluco54Glucose level QTL 542blood glucose amount (VT:0000188)blood glucose level (CMO:0000046)9125408446254084Rat
61425Cia15Collagen induced arthritis QTL 154.6joint integrity trait (VT:0010548)joint inflammation composite score (CMO:0000919)9510982642921101Rat
631211Bw4Body weight QTL45.31retroperitoneal fat pad mass (VT:0010430)retroperitoneal fat pad weight to body weight ratio (CMO:0000635)9510982650109826Rat
11353947Bp392Blood pressure QTL 392arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)9728325252283252Rat
61450Ciaa3CIA Autoantibody QTL 36.5blood autoantibody amount (VT:0003725)calculated serum anti-type 2 collagen antibody titer (CMO:0001279)9795472022071169Rat
9589133Insul26Insulin level QTL 2617.960.001blood insulin amount (VT:0001560)plasma insulin level (CMO:0000342)9895256053952560Rat
7411609Foco16Food consumption QTL 1625.60.001eating behavior trait (VT:0001431)feed conversion ratio (CMO:0001312)9895256053952560Rat
1600365Mcs20Mammary carcinoma susceptibility QTL 203mammary gland integrity trait (VT:0010552)mammary tumor growth rate (CMO:0000344)91353377042791750Rat
724543Cm20Cardiac mass QTL 203.9heart mass (VT:0007028)calculated heart weight (CMO:0000073)91696139840594091Rat


Additional Information

RGD Curation Notes
Note Type Note Reference
Database Acc Id Source(s)
NCBI Gene 100364635 UniSTS
NCBI Nucleotide AF054130
UniSTS 240279 UniSTS