D4Arb24 Marker Search Result - Rat Genome Database
Submit Data |  Help |  Video Tutorials |  News |  Publications |  FTP Download |  REST API |  Citing RGD |  Contact   

Marker: D4Arb24

Symbol: D4Arb24
Also known as: oxsts7880; 
RGD ID: 61302
Expected Size: 0 (bp)
Position
Rat AssemblyChrPosition (strand)SourceJBrowse
Cytogenetic Map4 RGD
Is Marker For: QTLs:   Scwia1   Cia3   Aia3  


Annotation



Strains and Sequence

Sequence
 
Forward Primer TCAACATGCTCCTATAACAGCA
Reverse Primer TTAGAGGATCCTTGAACTGTCT
 

Region

Nucleotide Sequences


Additional Information

RGD Curation Notes
Note Type Note Reference
Database Acc Id Source(s)
NCBI Gene 140549 UniSTS
  326415 UniSTS
  326478 UniSTS
NCBI Nucleotide U49068
UniSTS 240022 UniSTS