D1Wox6 Marker Search Result - Rat Genome Database

Send us a Message



Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   

Marker: D1Wox6

Symbol: D1Wox6
Previously known as: oxsts4640; RCA09.01; 
RGD ID: 60787
Expected Size: 190 (bp)
Position
Rat AssemblyChrPosition (strand)SourceJBrowse
Rnor_6.01137,787,261 - 137,787,460NCBIRnor6.0
Rnor_5.01138,777,913 - 138,778,112UniSTSRnor5.0
RGSC_v3.41131,956,599 - 131,956,825RGDRGSC3.4
RGSC_v3.41131,956,600 - 131,956,825UniSTSRGSC3.4
Celera1122,135,860 - 122,136,051UniSTS
RH 3.4 Map11041.2RGD
RH 3.4 Map11041.2UniSTS
Is Marker For: Strains:   SS.LEW-(D1Mco2-D1Wox6)/Jr   SS.LEW-(D1Mco55-D1Wox6)/Bj   SS.LEW-(D1Mco134-D1Wox6)/Bj  
QTLs:   Bp26   Mcs3   Rends1  


Annotation


References - curated
# Reference Title Reference Citation
1. A linkage map of the rat genome derived from three F2 crosses. Bihoreau MT, etal., Genome Res 1997 May;7(5):434-40.
2. Data downloaded from Wellcome Trust, University of Oxford Data downloaded from Wellcome Trust, University of Oxford
3. High-density rat radiation hybrid maps containing over 24,000 SSLPs, genes, and ESTs provide a direct link to the rat genome sequence. Kwitek AE, etal., Genome Res. 2004 Apr;14(4):750-7
4. UniSTS Pipeline RGD automated pipelines
5. Genetic identification of multiple loci that control breast cancer susceptibility in the rat Shepel LA, etal., Genetics 1998 May;149(1):289-99

Strains and Sequence

Sequence
 
Forward Primer CCCCATCTATCTATCCAACGG
Reverse Primer CTCTGGGATGCTTTGTGAAGG
 

Region

Nucleotide Sequences
GenBank Nucleotide CH473980 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  CM000231 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles


Additional Information

Database Acc Id Source(s)
NCBI Gene 326385 UniSTS
UniSTS 239411 UniSTS