D4Got147 Marker Search Result - Rat Genome Database

Send us a Message



Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   

Marker: D4Got147

Symbol: D4Got147
Previously known as: OT00.88; oxsts2022; 
RGD ID: 60429
Expected Size: 146 (bp)
Position
Rat AssemblyChrPosition (strand)SourceJBrowse
mRatBN7.2454,991,591 - 54,991,735 (+)MAPPERmRatBN7.2
mRatBN7.21159,899,487 - 159,899,547 (+)MAPPERmRatBN7.2
mRatBN7.2649,959,051 - 49,959,119 (+)MAPPERmRatBN7.2
Rnor_6.0453,640,668 - 53,640,813NCBIRnor6.0
Rnor_5.0453,402,123 - 53,402,268UniSTSRnor5.0
RGSC_v3.4453,008,290 - 53,008,436RGDRGSC3.4
RGSC_v3.4453,008,291 - 53,008,436UniSTSRGSC3.4
RGSC_v3.1453,238,865 - 53,239,010RGD
Celera450,124,558 - 50,124,703UniSTS
RH 3.4 Map4283.11RGD
RH 3.4 Map4283.11UniSTS


Annotation


References - curated
# Reference Title Reference Citation
1. Data downloaded from Wellcome Trust, University of Oxford Data downloaded from Wellcome Trust, University of Oxford
2. High-density rat radiation hybrid maps containing over 24,000 SSLPs, genes, and ESTs provide a direct link to the rat genome sequence. Kwitek AE, etal., Genome Res. 2004 Apr;14(4):750-7
3. UniSTS Pipeline RGD automated pipelines

Strains and Sequence

Sequence
 
Forward Primer CTTCAGGGAACATTTACATTTTTT
Reverse Primer GGACTTTCTTTTACATTTCCATGG
 

Region

Genes in Region
The following Genes overlap with this region.    Full Report CSV TAB Printer Analysis Tools
RGD IDSymbolNameChrStartStopSpecies
1305730Atxn7l1ataxin 7-like 164975987649982323Rat
2122Apbb1amyloid beta precursor protein binding family B member 11159896889159920505Rat

Nucleotide Sequences
GenBank Nucleotide AU029035 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles


QTLs in Region (mRatBN7.2)
The following QTLs overlap with this region.    Full Report CSV TAB Printer Gviewer
RGD IDSymbolNameLODP ValueTraitSub TraitChrStartStopSpecies
2301972Bp325Blood pressure QTL 3254.8arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)6172227641Rat
1300164Rf15Renal function QTL 153.12renal blood flow trait (VT:2000006)absolute change in renal blood flow rate (CMO:0001168)6507449754641141Rat
4145119Mcs25Mammary carcinoma susceptibility QTL 250.0001mammary gland integrity trait (VT:0010552)ratio of deaths to total study population during a period of time (CMO:0001023)610894415110548006Rat
1578665Bss16Bone structure and strength QTL 164.4femur morphology trait (VT:0000559)bone trabecular cross-sectional area (CMO:0002311)61173566972593685Rat
1578668Bmd14Bone mineral density QTL 143.8femur mineral mass (VT:0010011)total volumetric bone mineral density (CMO:0001728)61173566972593685Rat
10401812Kidm54Kidney mass QTL 54kidney mass (VT:0002707)both kidneys wet weight (CMO:0000085)61436878859368788Rat
10401800Kidm49Kidney mass QTL 49kidney mass (VT:0002707)both kidneys wet weight (CMO:0000085)61436878859368788Rat
1576309Emca7Estrogen-induced mammary cancer QTL 74mammary gland integrity trait (VT:0010552)mammary tumor number (CMO:0000343)615107216107351382Rat
2292589Emca10Estrogen-induced mammary cancer QTL 100.048mammary gland integrity trait (VT:0010552)post-insult time to mammary tumor formation (CMO:0000345)61653614061536140Rat
1354664Slep2Serum leptin concentration QTL 24.49blood leptin amount (VT:0005667)serum leptin level (CMO:0000780)61653614071636405Rat
1641898Colcr4Colorectal carcinoma resistance QTL43.710.0007intestine integrity trait (VT:0010554)well differentiated malignant colorectal tumor surface area measurement (CMO:0002077)62033877762613667Rat
2293839Kiddil2Kidney dilation QTL 24.8kidney pelvis morphology trait (VT:0004194)hydronephrosis severity score (CMO:0001208)62086642281133036Rat
2293841Kiddil4Kidney dilation QTL 44.4kidney pelvis morphology trait (VT:0004194)hydronephrosis severity score (CMO:0001208)62086642281133036Rat
1331779Rf38Renal function QTL 382.876kidney blood vessel physiology trait (VT:0100012)absolute change in renal vascular resistance (CMO:0001900)63207442872227641Rat
634318Bw118Body weight QTL 1183.55abdominal fat pad mass (VT:1000711)abdominal fat pad weight (CMO:0000088)63330954957730294Rat
6893340Cm77Cardiac mass QTL 770.260.57heart mass (VT:0007028)heart weight to body weight ratio (CMO:0000074)63330954981132889Rat
1300143Rf14Renal function QTL 142.92renal blood flow trait (VT:2000006)absolute change in renal blood flow rate (CMO:0001168)63443413777102317Rat
1354632Scl29Serum cholesterol level QTL 293.74blood cholesterol amount (VT:0000180)serum total cholesterol level (CMO:0000363)63509870971636405Rat
634307Bp141Blood pressure QTL 1414arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)63523041780230417Rat
70199Coreg1Compensatory renal growth QTL 111.8kidney mass (VT:0002707)compensatory renal growth score (CMO:0001894)63569161857730540Rat
9590290Uminl2Urine mineral level QTL 23.960.001urine mineral amount (VT:0015086)urine electrolyte level (CMO:0000593)63878398983783989Rat
9590306Scort18Serum corticosterone level QTL 182.880.001blood corticosterone amount (VT:0005345)plasma corticosterone level (CMO:0001173)63878398983783989Rat
9590140Scort4Serum corticosterone level QTL 414.490.001blood corticosterone amount (VT:0005345)plasma corticosterone level (CMO:0001173)63878398983783989Rat
634330Pia16Pristane induced arthritis QTL 163.9joint integrity trait (VT:0010548)arthritic paw count (CMO:0001460)645790088104200226Rat
70225Bp58Blood pressure QTL 583.3arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)132356093162846471Rat
10059597Bp377Blood pressure QTL 3773.420.025arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)132737458199368955Rat
634314Niddm44Non-insulin dependent diabetes mellitus QTL 44blood glucose amount (VT:0000188)blood glucose level (CMO:0000046)149393289199050459Rat
1578780Cm52Cardiac mass QTL 523.30.0001heart mass (VT:0007028)heart wet weight (CMO:0000069)181591954219808434Rat
724521Uae1Urinary albumin excretion QTL 13.80.0001urine albumin amount (VT:0002871)urine albumin excretion rate (CMO:0000757)190508614173018436Rat
1358902Bw47Body weight QTL 471.67body mass (VT:0001259)body weight (CMO:0000012)190508614180359386Rat
1331793Bp200Blood pressure QTL 2003.71601arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)194494440172949803Rat
1331751Bp199Blood pressure QTL 1993.60022arterial blood pressure trait (VT:2000000)diastolic blood pressure (CMO:0000005)194494440181830018Rat
1331749Hrtrt11Heart rate QTL 112.973heart pumping trait (VT:2000009)heart rate (CMO:0000002)194494440198211706Rat
70209Niddm23Non-insulin dependent diabetes mellitus QTL 232.82blood glucose amount (VT:0000188)blood glucose level (CMO:0000046)194494440198324465Rat
731168Bp154Blood pressure QTL 1543.4arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)194642644214537671Rat
8655649Arrd1Age-related retinal degeneration QTL 14.89retinal layer morphology trait (VT:0003727)percentage of study population developing retinopathy during a period of time (CMO:0002453)1100357752183970443Rat
1354591Cm36Cardiac mass QTL 364.1heart left ventricle mass (VT:0007031)calculated heart weight (CMO:0000073)1102813953201278233Rat
1354615Cm32Cardiac mass QTL 325.2heart left ventricle mass (VT:0007031)heart left ventricle wet weight (CMO:0000071)1102813953201278233Rat
1354606Bp246Blood pressure QTL 2463.6arterial blood pressure trait (VT:2000000)pulse pressure (CMO:0000292)1102813953218753816Rat
1300158Bp173Blood pressure QTL 1733.48arterial blood pressure trait (VT:2000000)blood pressure time series experimental set point of the baroreceptor response (CMO:0002593)1115540693185145286Rat
7794788Mcs32Mammary carcinoma susceptibility QTL 322.61mammary gland integrity trait (VT:0010552)mammary tumor incidence/prevalence measurement (CMO:0000946)1115540693238914717Rat
631199Cm23Cardiac mass QTL 234.60.0004heart left ventricle mass (VT:0007031)heart left ventricle wet weight (CMO:0000071)1115585465172949803Rat
7421630Bp362Blood pressure QTL 3620.001arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)1118608292241799120Rat
2313060Bss71Bone structure and strength QTL 712.60.0001long bone metaphysis morphology trait (VT:0000133)tibia midshaft total cross-sectional area (CMO:0001715)1118944747163944747Rat
631205Bp196Blood pressure QTL 19640.0001arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)1118944897199050459Rat
1598850Bp297Blood pressure QTL 2972.1arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)1121006655166006655Rat
1598866Bp287Blood pressure QTL 2875.1arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)1121006655166006655Rat
61442Strs1Sensitivity to stroke QTL 17.4cerebrum integrity trait (VT:0010549)post-insult time to onset of cerebrovascular lesion (CMO:0002343)1121767634166767634Rat
2293140Bp313Blood pressure QTL 313arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)1121833674166833674Rat
631544Bp84Blood pressure QTL 845.6arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)1123350408181759564Rat
1358189Cstrr1Cold stress response QTL 10.0001catecholamine amount (VT:0010543)urine norepinephrine level (CMO:0001629)1123350408182418476Rat
1641895Bp298Blood pressure QTL 298arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)1123350408182418476Rat
1578770Stresp23Stress response QTL 23kidney sympathetic nerve activity (VT:0004050)stimulated renal sympathetic nerve activity to basal renal sympathetic nerve activity ratio (CMO:0001786)1123350408182418476Rat
631549Bp89Blood pressure QTL 895.7arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)1123350581201284552Rat
634348Bp138Blood pressure QTL 138arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)1125611501168883176Rat
9685799Bp375Blood pressure QTL 375arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)1125611501170611501Rat
631654Bp107Blood pressure QTL 107arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)1125611501170611501Rat
9685802Bp376Blood pressure QTL 376arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)1126540680171540680Rat
738006Anxrr14Anxiety related response QTL 1440.00035locomotor behavior trait (VT:0001392)amount of experiment time spent in a discrete space in an experimental apparatus (CMO:0000958)1130636910175636910Rat
738028Anxrr12Anxiety related response QTL 124.90.00001locomotor behavior trait (VT:0001392)amount of experiment time spent in a discrete space in an experimental apparatus (CMO:0000958)1130636910175636910Rat
6893347Bw98Body weight QTL 980.20.53body mass (VT:0001259)body weight (CMO:0000012)1133680936178680936Rat
6893361Bw104Body weight QTL 1040.590.27body mass (VT:0001259)body weight (CMO:0000012)1133680936178680936Rat
1558645Bw55Body weight QTL 553.20.004body mass (VT:0001259)body weight (CMO:0000012)1133680936178680936Rat
631206Niddm40Non-insulin dependent diabetes mellitus QTL 40blood glucose amount (VT:0000188)plasma glucose level (CMO:0000042)1136745990163747690Rat
71118Thym1Thymus enlargement QTL 110.170.001thymus mass (VT:0004954)thymus weight to body weight ratio (CMO:0000612)1136829932181829932Rat
724550Thym3Thymus enlargement QTL 37.820.001thymus mass (VT:0004954)thymus weight to body weight ratio (CMO:0000612)1136829932181829932Rat
631519Pia11Pristane induced arthritis QTL 115.3joint integrity trait (VT:0010548)joint inflammation composite score (CMO:0000919)1136830018181830018Rat
1598853Memor3Memory QTL 34.5exploratory behavior trait (VT:0010471)total horizontal distance resulting from voluntary locomotion in an experimental apparatus (CMO:0001443)1143506580212458660Rat
61348Bp30Blood pressure QTL 302.4arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)1144017057197814409Rat
70160Bw18Body weight QTL 185.7body mass (VT:0001259)body weight (CMO:0000012)1144267353196383668Rat
737828Hcas3Hepatocarcinoma susceptibility QTL 34.9liver integrity trait (VT:0010547)liver tumorous lesion volume to total liver volume ratio (CMO:0001082)1144267353222987745Rat
2302378Insul11Insulin level QTL 113.25blood insulin amount (VT:0001560)serum insulin level (CMO:0000358)1144267353251128347Rat
634315Niddm45Non-insulin dependent diabetes mellitus QTL 457.16blood glucose amount (VT:0000188)plasma glucose level (CMO:0000042)1144267916172949660Rat
61379Bp44Blood pressure QTL 4419.2arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)1144267916174133260Rat
7771612Cm80Cardiac mass QTL 808.4heart left ventricle mass (VT:0007031)heart left ventricle weight (CMO:0000776)1149448574221264292Rat
724531Uae5Urinary albumin excretion QTL 54urine albumin amount (VT:0002871)urine albumin level (CMO:0000130)1150700142252085212Rat
1578759Uae30Urinary albumin excretion QTL 303.30.003urine albumin amount (VT:0002871)urine albumin excretion rate (CMO:0000757)1150700247252085048Rat
1578778Pur4Proteinuria QTL 43.30.003urine total protein amount (VT:0000032)urine total protein excretion rate (CMO:0000756)1150700247252085048Rat
1354602Bw35Body weight QTL 3512.2body mass (VT:0001259)body weight (CMO:0000012)1151162512201278233Rat
1354620Kidm19Kidney mass QTL 194kidney mass (VT:0002707)calculated kidney weight (CMO:0000160)1151162512201278233Rat
1354634Kidm12Kidney mass QTL 123.9kidney mass (VT:0002707)right kidney wet weight (CMO:0000082)1151162512201278233Rat
1354636Lmblg1Limb length QTL 16.4tibia length (VT:0004357)tibia length (CMO:0000450)1151162512201278233Rat
1354610Bw34Body weight QTL 344.1body mass (VT:0001259)body weight (CMO:0000012)1151162512256448636Rat
1354646Kidm18Kidney mass QTL 185.7kidney mass (VT:0002707)calculated kidney weight (CMO:0000160)1151162512256448636Rat
1354661Bw33Body weight QTL 335.2body mass (VT:0001259)body weight (CMO:0000012)1151162512256448636Rat
1358886Bp260Blood pressure QTL 2603.67arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)1151162766225824951Rat
61343Bp28Blood pressure QTL 28arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)1151646613196646613Rat
1549837Hcar15Hepatocarcinoma resistance QTL 150.05liver integrity trait (VT:0010547)liver tumorous lesion number (CMO:0001068)1153136852260522016Rat
2303622Vencon6Ventilatory control QTL 60.001respiration trait (VT:0001943)respiration rate (CMO:0000289)1154561505199561505Rat
1582204Livw1Liver weight QTL 13.60.0003liver mass (VT:0003402)liver weight to body weight ratio (CMO:0000633)1155422851172949803Rat
4889428Stresp24Stress response QTL 240.05heart pumping trait (VT:2000009)absolute change in electrocardiographic low frequency R-R spectral component to high frequency R-R spectral component ratio (CMO:0002162)1155866514200866514Rat
631548Bp88Blood pressure QTL 8850.001arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)1156677124176484451Rat
1354618Kidm15Kidney mass QTL 155kidney mass (VT:0002707)left kidney wet weight (CMO:0000083)1156677124201278233Rat
2312420Pur17Proteinuria QTL 177.10.0001urine protein amount (VT:0005160)urine total protein excretion rate (CMO:0000756)1156677124218753816Rat
1354580Scort1Serum corticosterone level QTL 13.4blood corticosterone amount (VT:0005345)blood corticosterone level (CMO:0001172)1156677124256448636Rat
61347Bp197Blood pressure QTL 1974.2arterial blood pressure trait (VT:2000000)blood pressure measurement (CMO:0000003)1158633083203633083Rat
619616Bp79Blood pressure QTL 790.0292arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)4521460278882945Rat
2303168Bp330Blood pressure QTL 3304.250.017arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)45214602146446691Rat
2302371Stl22Serum triglyceride level QTL 225.15blood triglyceride amount (VT:0002644)serum triglyceride level (CMO:0000360)4521829457114705Rat
1358203Stl19Serum triglyceride level QTL 192.80.002blood triglyceride amount (VT:0002644)serum triglyceride level (CMO:0000360)4521829465958103Rat
631642Stl2Serum triglyceride level QTL 23.3blood triglyceride amount (VT:0002644)serum triglyceride level (CMO:0000360)4521917856647776Rat
6478724Anxrr35Anxiety related response QTL 350.00449defecation behavior trait (VT:0010462)defecation measurement (CMO:0000997)41008408955084089Rat
6478766Anxrr47Anxiety related response QTL 470.09637locomotor behavior trait (VT:0001392)number of entries into a discrete space in an experimental apparatus (CMO:0000960)41008408955084089Rat
6478769Anxrr48Anxiety related response QTL 480.02514locomotor behavior trait (VT:0001392)amount of experiment time spent in a discrete space in an experimental apparatus (CMO:0000958)41008408955084089Rat
8694374Bw155Body weight QTL 1553.390.001body lean mass (VT:0010483)lean tissue morphological measurement (CMO:0002184)41008408955084089Rat
9590304Scort17Serum corticosterone level QTL 174.960.001blood corticosterone amount (VT:0005345)plasma corticosterone level (CMO:0001173)41008408955084089Rat
8552906Pigfal3Plasma insulin-like growth factor 1 level QTL 3blood insulin-like growth factor amount (VT:0010479)plasma insulin-like growth factor 1 level (CMO:0001299)41008408955084089Rat
631261Tcas3Tongue tumor susceptibility QTL 36.88tongue integrity trait (VT:0010553)number of squamous cell tumors of the tongue with diameter greater than 3 mm (CMO:0001950)41081417091360527Rat
2316958Gluco58Glucose level QTL 5810blood glucose amount (VT:0000188)blood glucose level (CMO:0000046)411320076180699135Rat
2303585Bw86Body weight QTL 864body mass (VT:0001259)body weight (CMO:0000012)41467806559678065Rat
2313401Anxrr27Anxiety related response QTL 27aggression-related behavior trait (VT:0015014)tameness/aggressiveness composite score (CMO:0002136)41793350862933508Rat
61412Pia2Pristane induced arthritis QTL 23.9joint integrity trait (VT:0010548)post-insult time to onset of experimental arthritis (CMO:0001450)42133334362278020Rat
6909122Insul22Insulin level QTL 224.63blood insulin amount (VT:0001560)plasma insulin level (CMO:0000342)42690728575585128Rat
6909128Pancm4Pancreatic morphology QTL 411.35pancreas mass (VT:0010144)pancreas wet weight (CMO:0000626)42690728575585128Rat
8655906Rf60Renal function QTL 603.8blood creatinine amount (VT:0005328)creatinine clearance (CMO:0000765)42949419581006281Rat
12798520Anxrr55Anxiety related response QTL 554.450.01locomotor behavior trait (VT:0001392)number of rearing movements with lid-pushing in an experimental apparatus (CMO:0002715)432583980114627242Rat
8552782Vie1Viral induced encephalitis QTL 126.4brain integrity trait (VT:0010579)encephalitis incidence/prevalence measurement (CMO:0002361)43443048482490359Rat
8552801Bw143Body weight QTL 1437.3body mass (VT:0001259)change in body weight to body weight ratio (CMO:0002216)43443048482490359Rat
8552809Vie5Viral induced encephalitis QTL 525.3brain integrity trait (VT:0010579)encephalitis incidence/prevalence measurement (CMO:0002361)43443048482490359Rat
8655961Kidm43Kidney mass QTL 4318kidney mass (VT:0002707)both kidneys wet weight (CMO:0000085)436303261103194984Rat
1358352Srcrt3Stress Responsive Cort QTL 32.29blood corticosterone amount (VT:0005345)plasma corticosterone level (CMO:0001173)438465774146803430Rat
61475Aia2Adjuvant induced arthritis QTL 25.8joint integrity trait (VT:0010548)joint inflammation composite score (CMO:0000919)43950527573892441Rat
1331807Rf31Renal function QTL 312.988urine potassium amount (VT:0010539)urine potassium level (CMO:0000128)43952426474726312Rat
1300139Hrtrt6Heart rate QTL 62.85heart pumping trait (VT:2000009)heart rate (CMO:0000002)439524264116179656Rat
61445Strs3Sensitivity to stroke QTL 33cerebrum integrity trait (VT:0010549)post-insult time to onset of cerebrovascular lesion (CMO:0002343)44043338885433388Rat
8694439Bw168Body weight QTL 1689.570.001retroperitoneal fat pad mass (VT:0010430)retroperitoneal fat pad weight to body weight ratio (CMO:0000635)44043341485433414Rat
6893678Bw108Body weight QTL 1082.60.006body mass (VT:0001259)body weight (CMO:0000012)44345797688457976Rat
1576305Emca6Estrogen-induced mammary cancer QTL 65.8mammary gland integrity trait (VT:0010552)mammary tumor number (CMO:0000343)444463720155883716Rat
1354612Foco1Food consumption QTL 18.87eating behavior trait (VT:0001431)food intake rate (CMO:0000427)444463908148090542Rat
1354660Salc1Saline consumption QTL 111.26drinking behavior trait (VT:0001422)saline drink intake rate (CMO:0001627)444463908148090542Rat
2312567Glom19Glomerulus QTL 191.90.006kidney glomerulus morphology trait (VT:0005325)index of glomerular damage (CMO:0001135)445456990146803430Rat
10450818Scl76Serum cholesterol level QTL 763.60.01blood VLDL cholesterol amount (VT:0005144)blood high density lipoprotein cholesterol level (CMO:0000052)44917811657114705Rat
10450821Scl77Serum cholesterol level QTL 774.10.01blood VLDL cholesterol amount (VT:0005144)blood high density lipoprotein cholesterol level (CMO:0000052)44917811657114705Rat
10450825Scl78Serum cholesterol level QTL 783.70.01blood VLDL cholesterol amount (VT:0005144)blood low density lipoprotein cholesterol level (CMO:0000053)44917811657114705Rat
1298082Stresp4Stress response QTL 4blood corticosterone amount (VT:0005345)plasma corticosterone level (CMO:0001173)450119848146803430Rat


Additional Information

Database Acc Id Source(s)
UniSTS 116000 UniSTS