Ppp2ca Marker Search Result - Rat Genome Database

	Submit Data \| Help \| Video Tutorials \| News \| Publications \| Download \| REST API \| Citing RGD \| Contact
	Search RGD Grant Resources Citing RGD About Us Contact Us Genes QTLs Strains Markers Genome Information Ontologies Cell Lines References Download Submit Data OntoMate (Literature Search) JBrowse (Genome Browser) Synteny Browser (VCMap) (beta) Variant Visualizer Multi-Ontology Enrichment (MOET) Gene-Ortholog Location Finder (GOLF) InterViewer (Protein-Protein Interactions) PhenoMiner (Quatitative Phenotypes) Gene Annotator OLGA (Gene List Generator) AllianceMine GViewer (Genome Viewer) Overgo Probe Designer Aging & Age-Related Disease Cancer & Neoplastic Disease Cardiovascular Disease COVID-19 Developmental Disease Diabetes Hematologic Disease Immune & Inflammatory Disease Infectious Disease Liver Disease Neurological Disease Obesity & Metabolic Syndrome Renal Disease Respiratory Disease Sensory Organ Disease Find Models new Genetic Models Autism Models Rat PhenoMiner (Quantitative Phenotypes) Chinchilla PhenoMiner Expected Ranges (Quantitative Phenotype) PhenoMiner Term Comparison Hybrid Rat Diversity Panel Phenotypes GERRC (Gene Editing Rat Resource Center) Phenotypes in Other Animal Models Animal Husbandry Strain Medical Records Phylogenetics Strain Availability Calendar Rats 101 Submissions Photo Archive Pathways Rat Community Forum Directory of Rat Laboratories Video Tutorials News RGD Publications RGD Poster Archive Nomenclature Guidelines Resource Links Laboratory Resources Employment Resources
	Advanced Search (OLGA)

General

Marker: Ppp2ca

Symbol:

Ppp2ca

Previously known as:

RGD ID:

5505300

Expected Size:

51 (bp)

Position

Rat Assembly	Chr	Position (strand)	Source	JBrowse
mRatBN7.2	10	36,373,858 - 36,373,905 (+)	MAPPER	mRatBN7.2
mRatBN7.2	11	82,279,039 - 82,279,090 (+)	MAPPER	mRatBN7.2
Rnor_6.0	11	86,421,789 - 86,421,839	NCBI	Rnor6.0
Rnor_5.0	11	89,522,528 - 89,522,578	UniSTS	Rnor5.0
RGSC_v3.4	11	84,270,657 - 84,270,707	UniSTS	RGSC3.4
Cytogenetic Map	10	q22	UniSTS

Is Marker For:

Genes: Ppp2ca LOC100362453

Annotation

References - curated

#	Reference Title	Reference Citation
1.	UniSTS Pipeline	RGD automated pipelines

Strains and Sequence

Sequence


Forward Primer	CATGAGGGTCCAATGTGTGACT
Reverse Primer	ACCACGGTCATCTGGATCTGA

Region

Genes in Region

The following Genes overlap with this region.

RGD ID	Symbol	Name	Chr	Start	Stop	Species
2318135	LOC100362453	serine/threonine-protein phosphatase 2A catalytic subunit alpha-like	11	82278288	82280159	Rat

Nucleotide Sequences


RefSeq Transcripts	XM_003751091.1	(Get FASTA)	NCBI Sequence Viewer	Search GEO for Microarray Profiles
GenBank Nucleotide	BC070914	(Get FASTA)	NCBI Sequence Viewer	Search GEO for Microarray Profiles
	BC072531	(Get FASTA)	NCBI Sequence Viewer	Search GEO for Microarray Profiles
	FQ228785	(Get FASTA)	NCBI Sequence Viewer	Search GEO for Microarray Profiles
	M33114	(Get FASTA)	NCBI Sequence Viewer	Search GEO for Microarray Profiles
	X14159	(Get FASTA)	NCBI Sequence Viewer	Search GEO for Microarray Profiles

QTLs in Region (mRatBN7.2)

The following QTLs overlap with this region.

RGD ID	Symbol	Name	LOD	P Value	Trait	Sub Trait	Chr	Start	Stop	Species
724554	Iddm17	Insulin dependent diabetes mellitus QTL 17		0.001	blood glucose amount (VT:0000188)	blood glucose level (CMO:0000046)	11	18976208	86241447	Rat
724563	Uae10	Urinary albumin excretion QTL 10	6		urine albumin amount (VT:0002871)	urine albumin level (CMO:0000130)	11	27672410	82846715	Rat
1300110	Stl7	Serum triglyceride level QTL 7	4.64		blood triglyceride amount (VT:0002644)	plasma triglyceride level (CMO:0000548)	11	29528418	82566702	Rat
1300135	Rf19	Renal function QTL 19	3.38		blood creatinine amount (VT:0005328)	creatinine clearance (CMO:0000765)	11	40946188	82566702	Rat
2312566	Glom20	Glomerulus QTL 20	3.6	0.001	kidney glomerulus morphology trait (VT:0005325)	index of glomerular damage (CMO:0001135)	11	44285759	82566702	Rat
1581565	Pur10	Proteinuria QTL 10		0.0001	urine albumin amount (VT:0002871)	urine albumin excretion rate (CMO:0000757)	11	44803318	82846466	Rat
1581572	Uae35	Urinary albumin excretion QTL 35		0.0001	urine albumin amount (VT:0002871)	urine albumin excretion rate (CMO:0000757)	11	44803318	82846466	Rat
724561	Plsm4	Polydactyly-luxate syndrome (PLS) morphotypes QTL 4		0.0003	forelimb integrity trait (VT:0010562)	front foot phalanges count (CMO:0001947)	11	54457534	86241447	Rat
4889521	Gluco62	Glucose level QTL 62	2.82	0.001	blood glucose amount (VT:0000188)	blood glucose level (CMO:0000046)	11	55136729	82993457	Rat
7411658	Foco27	Food consumption QTL 27	16.2	0.001	eating behavior trait (VT:0001431)	feed conversion ratio (CMO:0001312)	11	56351424	86241447	Rat
631506	Bp104	Blood pressure QTL 104	2.8		arterial blood pressure trait (VT:2000000)	systolic blood pressure (CMO:0000004)	11	59802794	82566545	Rat
70208	Niddm22	Non-insulin dependent diabetes mellitus QTL 22	3.61		blood glucose amount (VT:0000188)	plasma glucose level (CMO:0000042)	11	59802794	82566553	Rat
10058954	Gmadr7	Adrenal mass QTL 7	2.49	0.0049	adrenal gland mass (VT:0010420)	both adrenal glands wet weight to body weight ratio (CMO:0002411)	11	60346590	86241447	Rat
634339	Niddm50	Non-insulin dependent diabetes mellitus QTL 50	3.32		blood glucose amount (VT:0000188)	plasma glucose level (CMO:0000042)	11	66422148	86241447	Rat
1354593	Stl12	Serum triglyceride level QTL 12	3.36		blood triglyceride amount (VT:0002644)	serum triglyceride level (CMO:0000360)	11	66422148	86241447	Rat
1354656	Bvd3	Brain ventricular dilatation QTL 3	3.64	0.001	brain ventricle morphology trait (VT:0000822)	hydrocephalus severity score (CMO:0001881)	11	69446070	82846715	Rat
10450831	Scl80	Serum cholesterol level QTL 80	4.7	0.01	blood LDL cholesterol amount (VT:0000181)	blood low density lipoprotein cholesterol level (CMO:0000053)	11	76957131	83051965	Rat

Additional Information

External Database Links

Database	Acc Id	Source(s)
NCBI Gene	100362453	UniSTS
	24672	UniSTS
UniSTS	526871	UniSTS

Gene Annotator (Functional Annotation) unavailable	Gene Annotator (Annotation Distribution) unavailable	Variant Visualizer (Genomic Variants) unavailble Variant Visualizer (Genomic Variants) unavailable
Gene Annotator (Functional Annotation)	Gene Annotator (Annotation Distribution)	Variant Visualizer (Genomic Variants)

InterViewer (Protein-Protein Interactions) unavailable	Gviewer (Genome Viewer) unavailable	Variant Visualizer (Damaging Variants) unavailble Variant Visualizer (Damaging Variants) unavailable
InterViewer (Protein-Protein Interactions)	GViewer (Genome Viewer)	Variant Visualizer (Damaging Variants)

Gene Annotator (Annotation Comparison) unavailable	OLGA (Gene List Generator) unavailable
Gene Annotator (Annotation Comparison)	OLGA (Gene List Generator)	Excel (Download)

MOET (Multi-Ontology Enrichement) unavailable	GOLF (Gene-Ortholog Location Finder) unavailable
MOET (Multi-Ontology Enrichement)	GOLF (Gene-Ortholog Location Finder)

Create Name:

Description:

Send us a Message

Marker: Ppp2ca