PMC86057P1 Marker Search Result - Rat Genome Database

Send us a Message



Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   

Marker: PMC86057P1

Symbol: PMC86057P1
Previously known as:
RGD ID: 5504736
Expected Size: 268 (bp)
Position
Rat AssemblyChrPosition (strand)SourceJBrowse
mRatBN7.23109,191,235 - 109,191,478 (+)MAPPERmRatBN7.2
mRatBN7.210103,036,286 - 103,036,632 (+)MAPPERmRatBN7.2
Rnor_6.010106,819,088 - 106,819,433NCBIRnor6.0
Rnor_6.03114,182,471 - 114,182,713NCBIRnor6.0
Rnor_5.03120,723,143 - 120,723,385UniSTSRnor5.0
Rnor_5.010106,458,313 - 106,458,658UniSTSRnor5.0
RGSC_v3.43109,022,992 - 109,023,234UniSTSRGSC3.4
Celera10101,596,270 - 101,596,615UniSTS
Celera3108,089,043 - 108,089,285UniSTS
Cytogenetic Map3q35UniSTS
Is Marker For: Genes:   Sord   Tk1   LOC691694  


Annotation


References - curated
# Reference Title Reference Citation
1. UniSTS Pipeline RGD automated pipelines

Strains and Sequence

Sequence
 
Forward Primer CAGCATCTTGAACCTGGTGC
Reverse Primer CTGAGAGGCAAAGAGCTTCC
 

Region

Genes in Region
The following Genes overlap with this region.    Full Report CSV TAB Printer Analysis Tools
RGD IDSymbolNameChrStartStopSpecies
621014Tk1thymidine kinase 110103034755103046125Rat
3734Sordsorbitol dehydrogenase3109184697109216133Rat
40992335Tk1-ps2thymidine kinase 1, pseudogene 23109191206109192343Rat

Nucleotide Sequences
RefSeq Transcripts NM_052800 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
GenBank Nucleotide FQ229684 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles


QTLs in Region (mRatBN7.2)
The following QTLs overlap with this region.    Full Report CSV TAB Printer Gviewer
RGD IDSymbolNameLODP ValueTraitSub TraitChrStartStopSpecies
1354641Bvd2Brain ventricular dilatation QTL 26.360.001brain ventricle morphology trait (VT:0000822)hydrocephalus severity score (CMO:0001881)1093223816107057807Rat
61449Ciaa2CIA Autoantibody QTL 27.1blood autoantibody amount (VT:0003725)calculated serum anti-type 2 collagen antibody titer (CMO:0001279)1063221094107211142Rat
61325Aia5Adjuvant induced arthritis QTL 50.01joint integrity trait (VT:0010548)joint inflammation composite score (CMO:0000919)1023444813104060283Rat
1298078Stresp5Stress response QTL 52.990.00025blood corticosterone amount (VT:0005345)plasma corticosterone level (CMO:0001173)1042045676104670812Rat
1579915Bp280Blood pressure QTL 2800.001arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)1090404397107211142Rat
2298548Neuinf7Neuroinflammation QTL 73.4nervous system integrity trait (VT:0010566)spinal cord RT1-B protein level (CMO:0002132)1072224939107211142Rat
1302404Cia27Collagen induced arthritis QTL 272.60.0045joint integrity trait (VT:0010548)experimental arthritis severity measurement (CMO:0001459)1076452683107211142Rat
2317754Glom25Glomerulus QTL 253.5urine protein amount (VT:0005160)urine protein level (CMO:0000591)1082685200107211142Rat
70171Cari1Carrageenan-induced inflammation QTL 14.90.0005hypodermis integrity trait (VT:0010550)inflammatory exudate volume (CMO:0001429)1053797385107211142Rat
10450493Bp382Blood pressure QTL 3820.002arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)1094759759107211142Rat
1578672Bmd16Bone mineral density QTL 166.2femur mineral mass (VT:0010011)compact volumetric bone mineral density (CMO:0001730)1096703043107057807Rat
61354Pia10Pristane induced arthritis QTL 100.01joint integrity trait (VT:0010548)joint inflammation composite score (CMO:0000919)1023444813104060283Rat
2313103Bss80Bone structure and strength QTL 8020.0001tibia strength trait (VT:1000284)tibia midshaft endosteal cross-sectional area (CMO:0001716)1062057807107057807Rat
2293646Bss25Bone structure and strength QTL 2510.960.0001femur morphology trait (VT:0000559)femur cross-sectional area (CMO:0001661)1069738412107211142Rat
2303118Mamtr7Mammary tumor resistance QTL 70.003mammary gland integrity trait (VT:0010552)mammary tumor growth rate (CMO:0000344)109658275104670812Rat
2300172Bmd57Bone mineral density QTL 579.80.0001femur mineral mass (VT:0010011)volumetric bone mineral density (CMO:0001553)1069738412107211142Rat
70193Mcs7Mammary carcinoma susceptibility QTL 72.38mammary gland integrity trait (VT:0010552)mammary tumor number (CMO:0000343)1072224939107211142Rat
2313105Bss79Bone structure and strength QTL 791.80.0001tibia size trait (VT:0100001)tibia midshaft cross-sectional area (CMO:0001717)1062057807107057807Rat
61363Oia3Oil induced arthritis QTL 30.001joint integrity trait (VT:0010548)joint inflammation composite score (CMO:0000919)1087307617107211142Rat
2316949Gluco60Glucose level QTL 603.7blood glucose amount (VT:0000188)blood glucose level (CMO:0000046)1014487011107057807Rat
724530Bp149Blood pressure QTL 1490.0001arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)1090627439107211142Rat
1300137Bp186Blood pressure QTL 1863.57arterial blood pressure trait (VT:2000000)blood pressure time series experimental set point of the baroreceptor response (CMO:0002593)1090627439107057807Rat
2293663Bss33Bone structure and strength QTL 339.340.0001femur strength trait (VT:0010010)femur midshaft polar moment of inertia (CMO:0001669)1069738412107211142Rat
1578663Bss18Bone structure and strength QTL 183.6femur width (VT:1000666)femoral neck width (CMO:0001695)1096703043107057807Rat
12880384Cm107Cardiac mass QTL 1070.001heart mass (VT:0007028)heart wet weight to body weight ratio (CMO:0002408)90404397107211142Rat
12880385Cm108Cardiac mass QTL 1080.001heart left ventricle mass (VT:0007031)heart left ventricle weight to body weight ratio (CMO:0000530)90404397107211142Rat
2317029Aia19Adjuvant induced arthritis QTL 192.98joint integrity trait (VT:0010548)left rear ankle joint diameter (CMO:0002149)1066978955107211142Rat
2303589Bw87Body weight QTL 872body mass (VT:0001259)body weight (CMO:0000012)1081285008107211142Rat
12880396Am13Aortic mass QTL 130.001aorta mass (VT:0002845)aorta weight to aorta length to body weight ratio (CMO:0002722)1090404397107211142Rat
12880398Kidm67Kidney mass QTL 670.001kidney mass (VT:0002707)both kidneys wet weight to body weight ratio (CMO:0000340)1090404397107211142Rat
61387Bp1Blood pressure QTL 15.1arterial blood pressure trait (VT:2000000)diastolic blood pressure (CMO:0000005)1051770177107211142Rat
2317039Aia6Adjuvant induced arthritis QTL 64.31joint integrity trait (VT:0010548)right rear ankle joint diameter (CMO:0002150)1066978955107211142Rat
12880395Cm109Cardiac mass QTL 1090.001heart right ventricle mass (VT:0007033)heart right ventricle weight to body weight ratio (CMO:0000914)1090404397107211142Rat
61396Bp9Blood pressure QTL 94.80.0001arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)1068420376107211142Rat
634320Niddm49Non-insulin dependent diabetes mellitus QTL 494.41blood glucose amount (VT:0000188)plasma glucose level (CMO:0000042)1088539139107211142Rat
1331791Cm31Cardiac mass QTL 313.84606heart mass (VT:0007028)heart wet weight (CMO:0000069)1029299504107211142Rat
10450498Bp384Blood pressure QTL 3840.002arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)1067750049107211142Rat
4889492Pancm2Pancreatic morphology QTL 23.2pancreatic beta cell morphology trait (VT:0005217)ratio of insulin-positive cell area to total area of splenic region of pancreas (CMO:0001814)1076748906107211142Rat
6893366Bw106Body weight QTL 1060.30.47body mass (VT:0001259)body weight (CMO:0000012)1070199100107211142Rat
2293698Bss43Bone structure and strength QTL 435.330.0001lumbar vertebra size trait (VT:0010518)lumbar vertebra cross-sectional area (CMO:0001689)1059209888104209888Rat
1576313Pia25Pristane induced arthritis QTL 25joint integrity trait (VT:0010548)joint inflammation composite score (CMO:0000919)1096120911104060283Rat
631267Cia20Collagen induced arthritis QTL 203.2joint integrity trait (VT:0010548)joint inflammation composite score (CMO:0000919)1023444813104060283Rat
1576307Cia28Collagen induced arthritis QTL 28joint integrity trait (VT:0010548)joint inflammation composite score (CMO:0000919)1096120911104060283Rat
631269Cia22Collagen induced arthritis QTL 228.9joint integrity trait (VT:0010548)joint inflammation composite score (CMO:0000919)1040035094104060283Rat
631268Cia21Collagen induced arthritis QTL 213.1joint integrity trait (VT:0010548)joint inflammation composite score (CMO:0000919)1014487011104060283Rat
631270Cia23Collagen induced arthritis QTL 233.9joint integrity trait (VT:0010548)joint inflammation composite score (CMO:0000919)1040035094104060283Rat
2292438Bp311Blood pressure QTL 311arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)1076246085107211142Rat
2292436Bp310Blood pressure QTL 310arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)1094759759107211142Rat
1600367Mcs15Mammary carcinoma susceptibility QTL 154.5mammary gland integrity trait (VT:0010552)mammary tumor number (CMO:0000343)1085565469103884409Rat
631539Oia6Oil induced arthritis QTL 6joint integrity trait (VT:0010548)joint inflammation composite score (CMO:0000919)1097010147104670812Rat
631538Oia5Oil induced arthritis QTL 5joint integrity trait (VT:0010548)joint inflammation composite score (CMO:0000919)1087055121107211142Rat
61436Cia5Collagen induced arthritis QTL 54.9joint integrity trait (VT:0010548)joint inflammation composite score (CMO:0000919)1091228102104060283Rat
1642980Bp300Blood pressure QTL 300arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)1068383129107211142Rat
1354641Bvd2Brain ventricular dilatation QTL 26.360.001brain ventricle morphology trait (VT:0000822)hydrocephalus severity score (CMO:0001881)1093223816107057807Rat
1582238Bw68Body weight QTL 683.20.0064body mass (VT:0001259)body weight (CMO:0000012)353184593115665732Rat
2302373Gluco39Glucose level QTL 395.01blood glucose amount (VT:0000188)blood glucose level area under curve (AUC) (CMO:0000350)398535386161695835Rat
1582239Epfw1Epididymal fat weight QTL 14.50.0006epididymal fat pad mass (VT:0010421)epididymal fat pad weight to body weight ratio (CMO:0000658)353184593115665732Rat
61449Ciaa2CIA Autoantibody QTL 27.1blood autoantibody amount (VT:0003725)calculated serum anti-type 2 collagen antibody titer (CMO:0001279)1063221094107211142Rat
61325Aia5Adjuvant induced arthritis QTL 50.01joint integrity trait (VT:0010548)joint inflammation composite score (CMO:0000919)1023444813104060283Rat
1298078Stresp5Stress response QTL 52.990.00025blood corticosterone amount (VT:0005345)plasma corticosterone level (CMO:0001173)1042045676104670812Rat
1358362Srcrt2Stress Responsive Cort QTL 22.78blood corticosterone amount (VT:0005345)plasma corticosterone level (CMO:0001173)338192233133483320Rat
1582216Bw65Body weight QTL 656.3body mass (VT:0001259)body weight (CMO:0000012)3102200529115665732Rat
737818Hcar12Hepatocarcinoma resistance QTL 122.6liver integrity trait (VT:0010547)volume of individual liver tumorous lesion (CMO:0001078)329463235118376539Rat
1582218Bw74Body weight QTL 743.90.0021body mass (VT:0001259)body weight (CMO:0000012)353184593115665732Rat
1579915Bp280Blood pressure QTL 2800.001arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)1090404397107211142Rat
1582219Bw63Body weight QTL 633.80.001body mass (VT:0001259)body weight (CMO:0000012)396127817115665732Rat
1582221Kidm30Kidney mass QTL 303.50.0008kidney mass (VT:0002707)both kidneys wet weight (CMO:0000085)364655305115665732Rat
2298548Neuinf7Neuroinflammation QTL 73.4nervous system integrity trait (VT:0010566)spinal cord RT1-B protein level (CMO:0002132)1072224939107211142Rat
1302404Cia27Collagen induced arthritis QTL 272.60.0045joint integrity trait (VT:0010548)experimental arthritis severity measurement (CMO:0001459)1076452683107211142Rat
1581568Rf53Renal function QTL 53urine total protein amount (VT:0000032)urine protein excretion rate to body weight ratio (CMO:0001099)356395968161299569Rat
2317754Glom25Glomerulus QTL 253.5urine protein amount (VT:0005160)urine protein level (CMO:0000591)1082685200107211142Rat
70171Cari1Carrageenan-induced inflammation QTL 14.90.0005hypodermis integrity trait (VT:0010550)inflammatory exudate volume (CMO:0001429)1053797385107211142Rat
1582210Bw71Body weight QTL 713.30.0012body mass (VT:0001259)body weight (CMO:0000012)364655305115665732Rat
1300111Rf12Renal function QTL 123.78renal blood flow trait (VT:2000006)absolute change in renal blood flow rate (CMO:0001168)361017749121056321Rat
724523Tsu1Thymus enlargement suppressive QTL 13.84thymus mass (VT:0004954)thymus weight to body weight ratio (CMO:0000612)350437504115638231Rat
8694437Bw167Body weight QTL 16722.460.001retroperitoneal fat pad mass (VT:0010430)retroperitoneal fat pad weight to body weight ratio (CMO:0000635)391797474136797474Rat
10450493Bp382Blood pressure QTL 3820.002arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)1094759759107211142Rat
8662816Vetf4Vascular elastic tissue fragility QTL 44renal artery integrity trait (VT:0010642)number of ruptures of the internal elastic lamina of the renal arteries (CMO:0002563)359242096157323038Rat
1581503Cm58Cardiac mass QTL 582.70.05heart left ventricle mass (VT:0007031)heart left ventricle weight to body weight ratio (CMO:0000530)343827364121056321Rat
2292613Ept16Estrogen-induced pituitary tumorigenesis QTL 168.3pituitary gland mass (VT:0010496)pituitary gland wet weight (CMO:0000853)347233430110362260Rat
1578672Bmd16Bone mineral density QTL 166.2femur mineral mass (VT:0010011)compact volumetric bone mineral density (CMO:0001730)1096703043107057807Rat
631841Niddm39Non-insulin dependent diabetes mellitus QTL 393.36blood glucose amount (VT:0000188)blood glucose level (CMO:0000046)394856903159898684Rat
61354Pia10Pristane induced arthritis QTL 100.01joint integrity trait (VT:0010548)joint inflammation composite score (CMO:0000919)1023444813104060283Rat
2313103Bss80Bone structure and strength QTL 8020.0001tibia strength trait (VT:1000284)tibia midshaft endosteal cross-sectional area (CMO:0001716)1062057807107057807Rat
2293646Bss25Bone structure and strength QTL 2510.960.0001femur morphology trait (VT:0000559)femur cross-sectional area (CMO:0001661)1069738412107211142Rat
12879848Bw181Body weght QTL 1810.015body mass (VT:0001259)body weight (CMO:0000012)370348525121056321Rat
2303118Mamtr7Mammary tumor resistance QTL 70.003mammary gland integrity trait (VT:0010552)mammary tumor growth rate (CMO:0000344)109658275104670812Rat
2300172Bmd57Bone mineral density QTL 579.80.0001femur mineral mass (VT:0010011)volumetric bone mineral density (CMO:0001553)1069738412107211142Rat
70193Mcs7Mammary carcinoma susceptibility QTL 72.38mammary gland integrity trait (VT:0010552)mammary tumor number (CMO:0000343)1072224939107211142Rat
2301971Cm71Cardiac mass QTL 714.63heart left ventricle mass (VT:0007031)heart left ventricle weight (CMO:0000776)341874578155617519Rat
1358885Bp251Blood pressure QTL 2513.8arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)314489145121056321Rat
2301970Bw81Body weight QTL 815.19body mass (VT:0001259)body weight (CMO:0000012)341874578155617519Rat
2313105Bss79Bone structure and strength QTL 791.80.0001tibia size trait (VT:0100001)tibia midshaft cross-sectional area (CMO:0001717)1062057807107057807Rat
61363Oia3Oil induced arthritis QTL 30.001joint integrity trait (VT:0010548)joint inflammation composite score (CMO:0000919)1087307617107211142Rat
2316949Gluco60Glucose level QTL 603.7blood glucose amount (VT:0000188)blood glucose level (CMO:0000046)1014487011107057807Rat
724530Bp149Blood pressure QTL 1490.0001arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)1090627439107211142Rat
1300137Bp186Blood pressure QTL 1863.57arterial blood pressure trait (VT:2000000)blood pressure time series experimental set point of the baroreceptor response (CMO:0002593)1090627439107057807Rat
1358888Bp264Blood pressure QTL 2644.43arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)314489145121056321Rat
2293663Bss33Bone structure and strength QTL 339.340.0001femur strength trait (VT:0010010)femur midshaft polar moment of inertia (CMO:0001669)1069738412107211142Rat
1578663Bss18Bone structure and strength QTL 183.6femur width (VT:1000666)femoral neck width (CMO:0001695)1096703043107057807Rat
724532Cm17Cardiac mass QTL 172heart mass (VT:0007028)calculated heart weight (CMO:0000073)395735366140735366Rat
2312673Scl63Serum cholesterol level QTL 630.001blood cholesterol amount (VT:0000180)serum total cholesterol level (CMO:0000363)398535255168026850Rat
12880384Cm107Cardiac mass QTL 1070.001heart mass (VT:0007028)heart wet weight to body weight ratio (CMO:0002408)90404397107211142Rat
12880385Cm108Cardiac mass QTL 1080.001heart left ventricle mass (VT:0007031)heart left ventricle weight to body weight ratio (CMO:0000530)90404397107211142Rat
2301414Kidm37Kidney mass QTL 370.001kidney mass (VT:0002707)both kidneys wet weight to body weight ratio (CMO:0000340)370653097121056321Rat
2317029Aia19Adjuvant induced arthritis QTL 192.98joint integrity trait (VT:0010548)left rear ankle joint diameter (CMO:0002149)1066978955107211142Rat
2303589Bw87Body weight QTL 872body mass (VT:0001259)body weight (CMO:0000012)1081285008107211142Rat
12880396Am13Aortic mass QTL 130.001aorta mass (VT:0002845)aorta weight to aorta length to body weight ratio (CMO:0002722)1090404397107211142Rat
70216Cm14Cardiac mass QTL 142.1heart mass (VT:0007028)heart wet weight (CMO:0000069)331172320163586636Rat
12880398Kidm67Kidney mass QTL 670.001kidney mass (VT:0002707)both kidneys wet weight to body weight ratio (CMO:0000340)1090404397107211142Rat
61387Bp1Blood pressure QTL 15.1arterial blood pressure trait (VT:2000000)diastolic blood pressure (CMO:0000005)1051770177107211142Rat
2317039Aia6Adjuvant induced arthritis QTL 64.31joint integrity trait (VT:0010548)right rear ankle joint diameter (CMO:0002150)1066978955107211142Rat
2292591Esta4Estrogen-induced thymic atrophy QTL 4thymus mass (VT:0004954)thymus wet weight (CMO:0000855)347233211147415807Rat
12880395Cm109Cardiac mass QTL 1090.001heart right ventricle mass (VT:0007033)heart right ventricle weight to body weight ratio (CMO:0000914)1090404397107211142Rat
61396Bp9Blood pressure QTL 94.80.0001arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)1068420376107211142Rat
634320Niddm49Non-insulin dependent diabetes mellitus QTL 494.41blood glucose amount (VT:0000188)plasma glucose level (CMO:0000042)1088539139107211142Rat
1331791Cm31Cardiac mass QTL 313.84606heart mass (VT:0007028)heart wet weight (CMO:0000069)1029299504107211142Rat
10450498Bp384Blood pressure QTL 3840.002arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)1067750049107211142Rat
4889492Pancm2Pancreatic morphology QTL 23.2pancreatic beta cell morphology trait (VT:0005217)ratio of insulin-positive cell area to total area of splenic region of pancreas (CMO:0001814)1076748906107211142Rat
6893366Bw106Body weight QTL 1060.30.47body mass (VT:0001259)body weight (CMO:0000012)1070199100107211142Rat
2293698Bss43Bone structure and strength QTL 435.330.0001lumbar vertebra size trait (VT:0010518)lumbar vertebra cross-sectional area (CMO:0001689)1059209888104209888Rat
1600376Arunc5Aerobic running capacity QTL 50.21exercise endurance trait (VT:0002332)maximum distance run on treadmill (CMO:0001406)373376539118376539Rat
1576313Pia25Pristane induced arthritis QTL 25joint integrity trait (VT:0010548)joint inflammation composite score (CMO:0000919)1096120911104060283Rat
2302273Gluco35Glucose level QTL 355.30.001blood glucose amount (VT:0000188)blood glucose level (CMO:0000046)380800231114297550Rat
1559282Emca5Estrogen-induced mammary cancer QTL 53.9mammary gland integrity trait (VT:0010552)percentage of study population developing mammary tumors during a period of time (CMO:0000948)343827364169034231Rat
1354611Despr2Despair related QTL 23.030.0028locomotor behavior trait (VT:0001392)amount of time spent in voluntary immobility (CMO:0001043)397084464142084464Rat
631649Bp123Blood pressure QTL 1233.2arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)389772419134772419Rat
631267Cia20Collagen induced arthritis QTL 203.2joint integrity trait (VT:0010548)joint inflammation composite score (CMO:0000919)1023444813104060283Rat
1576307Cia28Collagen induced arthritis QTL 28joint integrity trait (VT:0010548)joint inflammation composite score (CMO:0000919)1096120911104060283Rat
619618Rf3Renal disease susceptibility QTL 36.50.001urine albumin amount (VT:0002871)urine albumin excretion rate to body weight ratio (CMO:0001270)3107693393152693393Rat
631269Cia22Collagen induced arthritis QTL 228.9joint integrity trait (VT:0010548)joint inflammation composite score (CMO:0000919)1040035094104060283Rat
631268Cia21Collagen induced arthritis QTL 213.1joint integrity trait (VT:0010548)joint inflammation composite score (CMO:0000919)1014487011104060283Rat
631270Cia23Collagen induced arthritis QTL 233.9joint integrity trait (VT:0010548)joint inflammation composite score (CMO:0000919)1040035094104060283Rat
2312659Slep7Serum leptin concentration QTL 70.001blood leptin amount (VT:0005667)serum leptin level (CMO:0000780)398535255168026850Rat
1581546Pur13Proteinuria QTL 132.930.0335urine total protein amount (VT:0000032)urine protein excretion rate (CMO:0000759)378196190146592722Rat
2292438Bp311Blood pressure QTL 311arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)1076246085107211142Rat
2292436Bp310Blood pressure QTL 310arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)1094759759107211142Rat
1600367Mcs15Mammary carcinoma susceptibility QTL 154.5mammary gland integrity trait (VT:0010552)mammary tumor number (CMO:0000343)1085565469103884409Rat
631665Bw8Body weight QTL 85.5body mass (VT:0001259)body weight (CMO:0000012)350437042119183768Rat
631539Oia6Oil induced arthritis QTL 6joint integrity trait (VT:0010548)joint inflammation composite score (CMO:0000919)1097010147104670812Rat
631538Oia5Oil induced arthritis QTL 5joint integrity trait (VT:0010548)joint inflammation composite score (CMO:0000919)1087055121107211142Rat
61436Cia5Collagen induced arthritis QTL 54.9joint integrity trait (VT:0010548)joint inflammation composite score (CMO:0000919)1091228102104060283Rat
1642980Bp300Blood pressure QTL 300arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)1068383129107211142Rat
2293087Iddm27Insulin dependent diabetes mellitus QTL 272.68blood glucose amount (VT:0000188)blood glucose level (CMO:0000046)397551417147415807Rat
2312670Bw94Body weight QTL 940.01inguinal fat pad mass (VT:0010424)inguinal fat pad weight to body weight ratio (CMO:0001253)398535255168026850Rat
1358186Ept2Estrogen-induced pituitary tumorigenesis QTL 28.3pituitary gland mass (VT:0010496)pituitary gland wet weight (CMO:0000853)347233430110362260Rat


Additional Information

Database Acc Id Source(s)
NCBI Gene 24788 UniSTS
  24834 UniSTS
  691694 UniSTS
UniSTS 273513 UniSTS