UniSTS:237391 Marker Search Result - Rat Genome Database

Send us a Message



Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   
Pathways

Marker: UniSTS:237391

Symbol: UniSTS:237391
Previously known as:
RGD ID: 5503234
Expected Size: 216 (bp)
Position
Rat AssemblyChrPosition (strand)SourceJBrowse
mRatBN7.21743,603,277 - 43,603,494 (+)MAPPERmRatBN7.2
Rnor_6.01745,678,398 - 45,678,613NCBIRnor6.0
Rnor_5.01757,793,457 - 57,793,672UniSTSRnor5.0
RGSC_v3.41751,257,751 - 51,257,966UniSTSRGSC3.4
Celera1752,875,809 - 52,876,024UniSTS


Annotation


References - curated
# Reference Title Reference Citation
1. UniSTS Pipeline RGD automated pipelines

Strains and Sequence

Sequence
 
Forward Primer GCAAAATCCTGTCTGGGGTA
Reverse Primer GGGCAGAAAACCCACAGTAA
 

Region

Genes in Region
The following Genes overlap with this region.    Full Report CSV TAB Printer Analysis Tools
RGD IDSymbolNameChrStartStopSpecies
41232344LOC120097780uncharacterized LOC120097780174356768943605638Rat

Nucleotide Sequences


QTLs in Region (mRatBN7.2)
The following QTLs overlap with this region.    Full Report CSV TAB Printer Gviewer
RGD IDSymbolNameLODP ValueTraitSub TraitChrStartStopSpecies
1354658Spl8Serum phospholipid level QTL 83.8blood VLDL phospholipid amount (VT:0010507)blood very low density lipoprotein phospholipid level (CMO:0001571)17160781592Rat
1354581Bp247Blood pressure QTL 2474.5arterial blood pressure trait (VT:2000000)pulse pressure (CMO:0000292)17169599340Rat
1354662Rf49Renal function QTL 492.9blood creatinine amount (VT:0005328)plasma creatinine level (CMO:0000537)17169599340Rat
1354596Bw32Body weight QTL 324.5body mass (VT:0001259)body weight (CMO:0000012)17429913060781592Rat
1354630Cm34Cardiac mass QTL 348.7heart left ventricle mass (VT:0007031)heart left ventricle wet weight (CMO:0000071)17429913069599340Rat
1354638Insul1Insulin level QTL 14.8blood insulin amount (VT:0001560)plasma insulin level (CMO:0000342)17429913069599340Rat
1354651Lmblg2Limb length QTL 26tibia length (VT:0004357)tibia length (CMO:0000450)17429913069599340Rat
2303627Vencon8Ventilatory control QTL 80.001respiration trait (VT:0001943)tidal volume (CMO:0000222)17452803849528038Rat
10054088Scort28Serum corticosterone level QTL 282.040.0102blood corticosterone amount (VT:0005345)plasma corticosterone level (CMO:0001173)17452803849528038Rat
2303561Bw91Body weight QTL 912body mass (VT:0001259)body weight (CMO:0000012)17886846253868462Rat
1331765Hrtrt15Heart rate QTL 154.094heart pumping trait (VT:2000009)heart rate (CMO:0000002)171533061355836425Rat
1354640Scl32Serum cholesterol level QTL 325.4blood HDL cholesterol amount (VT:0000184)blood high density lipoprotein cholesterol level (CMO:0000052)171578159260781592Rat
1354659Scl68Serum cholesterol level QTL 683.9blood VLDL cholesterol amount (VT:0005144)blood very low density lipoprotein cholesterol level (CMO:0000648)171578159260781592Rat
7394837Memor18Memory QTL 18exploratory behavior trait (VT:0010471)measurement of voluntary locomotion into, out of or within a discrete space in an experimental apparatus (CMO:0000957)171864018263640182Rat
1354628Stl13Serum triglyceride level QTL 133.8blood triglyceride amount (VT:0002644)blood triglyceride level (CMO:0000118)172129303960781592Rat
70157Niddm32Non-insulin dependent diabetes mellitus QTL 324.34blood glucose amount (VT:0000188)blood glucose level area under curve (AUC) (CMO:0000350)172245492450909196Rat
61394Bp8Blood pressure QTL 82.2arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)172308056759555013Rat
7488966Bp370Blood pressure QTL 3700.001arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)172365318457246843Rat
12903978Cm118Cardiac mass QTL 1180.001heart mass (VT:0007028)heart wet weight to body weight ratio (CMO:0002408)172365318468653184Rat
12903979Cm119Cardiac mass QTL 1190.001heart left ventricle mass (VT:0007031)heart left ventricle weight to body weight ratio (CMO:0000530)172365318468653184Rat
12903980Cm120Cardiac mass QTL 1200.002heart right ventricle mass (VT:0007033)heart right ventricle weight to body weight ratio (CMO:0000914)172365318468653184Rat
12903981Am17Aortic mass QTL 170.001aorta mass (VT:0002845)aorta weight to aorta length to body weight ratio (CMO:0002722)172365318468653184Rat
1559055Bp278Blood pressure QTL 2780.04arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)172365318468653184Rat
12903982Kidm70Kidney mass QTL 700.001kidney mass (VT:0002707)both kidneys wet weight to body weight ratio (CMO:0000340)172365318470974005Rat
1354619Bp242Blood pressure QTL 2426.3arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)172459934069599340Rat
1581512Cm55Cardiac mass QTL 552.80.05heart left ventricle mass (VT:0007031)heart left ventricle weight to body weight ratio (CMO:0000530)172702794956836890Rat
4889955Bss93Bone structure and strength QTL 934.4tibia size trait (VT:0100001)tibia cortical bone volume to tibia total bone volume ratio (CMO:0001727)172702794960463643Rat
2302377Scl61Serum cholesterol level QTL 614.36blood HDL cholesterol amount (VT:0000184)serum high density lipoprotein cholesterol level (CMO:0000361)172738994653481766Rat
8552928Pigfal9Plasma insulin-like growth factor 1 level QTL 99blood insulin-like growth factor amount (VT:0010479)plasma insulin-like growth factor 1 level (CMO:0001299)172840914773409147Rat
9590107Sffal7Serum free fatty acids level QTL 74.810.001blood free fatty acid amount (VT:0001553)plasma free fatty acids level (CMO:0000546)172840914773409147Rat
10450503Bp386Blood pressure QTL 3860.28arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)173136839162109574Rat
2324621Coatc5Coat color QTL 5coat/hair pigmentation trait (VT:0010463)pigmented ventral coat/hair area to total ventral coat/hair area ratio (CMO:0001812)173136839173951021Rat
2313854Bp343Blood pressure QTL 3433.9life span trait (VT:0005372)age at time of death (CMO:0001193)173199078450909196Rat
724549Niddm56Non-insulin dependent diabetes mellitus QTL 560.03blood glucose amount (VT:0000188)blood glucose level area under curve (AUC) (CMO:0000350)173199078476990784Rat
1354663Bvd5Brain ventricular dilatation QTL 53.510.001brain ventricle morphology trait (VT:0000822)hydrocephalus severity score (CMO:0001881)173199078481292925Rat
1300148Bp192Blood pressure QTL 1923.47arterial blood pressure trait (VT:2000000)blood pressure time series experimental set point of the baroreceptor response (CMO:0002593)173455084373951021Rat
724528Uae4Urinary albumin excretion QTL 44.90.0001urine albumin amount (VT:0002871)urine albumin excretion rate (CMO:0000757)173583708569599340Rat
2301412Kidm40Kidney mass QTL 400.001kidney mass (VT:0002707)both kidneys wet weight to body weight ratio (CMO:0000340)173747984782479847Rat
2317054Aia12Adjuvant induced arthritis QTL 124.24joint integrity trait (VT:0010548)left rear ankle joint diameter (CMO:0002149)173828150983281509Rat
2317060Aia26Adjuvant induced arthritis QTL 263.22joint integrity trait (VT:0010548)right rear ankle joint diameter (CMO:0002150)173828150983281509Rat
1598871Memor5Memory QTL 55.3exploratory behavior trait (VT:0010471)total horizontal distance resulting from voluntary locomotion in an experimental apparatus (CMO:0001443)174054004180387013Rat
1358295Aocep1Aortic cell protein QTL 16.10.00000071thoracic aorta cellular protein amount (VT:0010598)aortic cell percentage174099000585990005Rat
631497Bp98Blood pressure QTL 983.66arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)174135465160463643Rat
1354635Bp245Blood pressure QTL 2456arterial blood pressure trait (VT:2000000)diastolic blood pressure (CMO:0000005)174207316069599340Rat
1354635Bp245Blood pressure QTL 2456arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)174207316069599340Rat


Additional Information

Database Acc Id Source(s)
UniSTS 237391 UniSTS