Prkacb Marker Search Result - Rat Genome Database

Send us a Message



Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   
Pathways

Marker: Prkacb

Symbol: Prkacb
Previously known as:
RGD ID: 5503001
Expected Size: 80 (bp)
Position
Rat AssemblyChrPosition (strand)SourceJBrowse
mRatBN7.22235,655,423 - 235,656,709 (+)MAPPERmRatBN7.2
mRatBN7.21181,975,264 - 181,975,344 (+)MAPPERmRatBN7.2
Rnor_6.01198,801,261 - 198,801,340NCBIRnor6.0
Rnor_6.02252,620,866 - 252,622,151NCBIRnor6.0
Rnor_5.02271,147,965 - 271,149,250UniSTSRnor5.0
Rnor_5.01205,799,654 - 205,799,733UniSTSRnor5.0
RGSC_v3.41186,619,865 - 186,619,944UniSTSRGSC3.4
RGSC_v3.42244,964,862 - 244,966,147UniSTSRGSC3.4
Celera2227,632,322 - 227,633,607UniSTS
Celera1179,627,878 - 179,627,957UniSTS
Cytogenetic Map1q36UniSTS
Cytogenetic Map2q44UniSTS
Is Marker For: Genes:   Prkacb   LOC691879   LOC687804   LOC100360847  


Annotation


References - curated
# Reference Title Reference Citation
1. UniSTS Pipeline RGD automated pipelines

Strains and Sequence

Sequence
 
Forward Primer AGCCGGAAAACCTCTTAATTGAC
Reverse Primer CCTGCCCTTGACTCTTTTGG
 

Region

Genes in Region
The following Genes overlap with this region.    Full Report CSV TAB Printer Analysis Tools
RGD IDSymbolNameChrStartStopSpecies
1310574Prkacbprotein kinase cAMP-activated catalytic subunit beta2235636878235726928Rat
7608714Prkacb-ps1protein kinase cAMP-activated catalytic subunit beta, pseudogene 11181968826181977581Rat



QTLs in Region (mRatBN7.2)
The following QTLs overlap with this region.    Full Report CSV TAB Printer Gviewer
RGD IDSymbolNameLODP ValueTraitSub TraitChrStartStopSpecies
724534Uae6Urinary albumin excretion QTL 610urine albumin amount (VT:0002871)urine albumin level (CMO:0000130)278665619249053267Rat
1641891Alcrsp17Alcohol response QTL 17response to alcohol trait (VT:0010489)duration of loss of righting reflex (CMO:0002289)2149559561249053267Rat
2317752Glom23Glomerulus QTL 233.6urine protein amount (VT:0005160)urine protein level (CMO:0000591)2193452645245889826Rat
1598835Anxrr18Anxiety related response QTL 182.98body movement coordination trait (VT:0005424)number of rearing movements in an experimental apparatus (CMO:0001752)2200990457245990457Rat
2298479Eau5Experimental allergic uveoretinitis QTL 50.0021uvea integrity trait (VT:0010551)experimental autoimmune uveitis score (CMO:0001504)2202446871237938339Rat
7207490Bss111Bone structure and strength QTL 1116.4femur morphology trait (VT:0000559)femur midshaft cortical cross-sectional area (CMO:0001663)2211744537249053267Rat
7207482Bss107Bone structure and strength QTL 1077femur strength trait (VT:0010010)femur ultimate force (CMO:0001675)2211744537249053267Rat
7207484Bss108Bone structure and strength QTL 1085.3femur strength trait (VT:0010010)femur total energy absorbed before break (CMO:0001677)2211744537249053267Rat
1298075Scl17Serum cholesterol level QTL 173.4blood cholesterol amount (VT:0000180)plasma total cholesterol level (CMO:0000585)2211744537249053267Rat
1549836Bss2Bone structure and strength QTL 27.5femur strength trait (VT:0010010)femur midshaft polar moment of inertia (CMO:0001669)2211744537249053267Rat
2317885Alcrsp28Alcohol response QTL 282.10.63response to alcohol trait (VT:0010489)duration of loss of righting reflex (CMO:0002289)2212828222249053267Rat
1300126Bp175Blood pressure QTL 1753.46arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)2214226044247136170Rat
2313073Bmd75Bone mineral density QTL 754.10.0001tibia mineral mass (VT:1000283)total volumetric bone mineral density (CMO:0001728)2215377404237938339Rat
1331767Hrtrt12Heart rate QTL 123.373heart pumping trait (VT:2000009)heart rate (CMO:0000002)2218414747240841241Rat
2293833Kiddil8Kidney dilation QTL 82.9kidney pelvis morphology trait (VT:0004194)hydronephrosis severity score (CMO:0001208)2219753301247136170Rat
2293844Kiddil7Kidney dilation QTL 73.5kidney pelvis morphology trait (VT:0004194)hydronephrosis severity score (CMO:0001208)2219753301247136170Rat
9587428Epfw6Epididymal fat weight QTL 67.470.001epididymal fat pad mass (VT:0010421)epididymal fat pad weight to body weight ratio (CMO:0000658)2223389739249053267Rat
7411555Bw132Body weight QTL 1320.001body mass (VT:0001259)body weight gain (CMO:0000420)2223389739249053267Rat
631563Hcuc3Hepatic copper content QTL 33.87liver copper amount (VT:0003065)liver copper weight to liver dry weight ratio (CMO:0001512)2229059610249053267Rat
10059597Bp377Blood pressure QTL 3773.420.025arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)132737458199368955Rat
634314Niddm44Non-insulin dependent diabetes mellitus QTL 44blood glucose amount (VT:0000188)blood glucose level (CMO:0000046)149393289199050459Rat
1578780Cm52Cardiac mass QTL 523.30.0001heart mass (VT:0007028)heart wet weight (CMO:0000069)181591954219808434Rat
1331749Hrtrt11Heart rate QTL 112.973heart pumping trait (VT:2000009)heart rate (CMO:0000002)194494440198211706Rat
70209Niddm23Non-insulin dependent diabetes mellitus QTL 232.82blood glucose amount (VT:0000188)blood glucose level (CMO:0000046)194494440198324465Rat
731168Bp154Blood pressure QTL 1543.4arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)194642644214537671Rat
8655649Arrd1Age-related retinal degeneration QTL 14.89retinal layer morphology trait (VT:0003727)percentage of study population developing retinopathy during a period of time (CMO:0002453)1100357752183970443Rat
1354591Cm36Cardiac mass QTL 364.1heart left ventricle mass (VT:0007031)calculated heart weight (CMO:0000073)1102813953201278233Rat
1354615Cm32Cardiac mass QTL 325.2heart left ventricle mass (VT:0007031)heart left ventricle wet weight (CMO:0000071)1102813953201278233Rat
1354606Bp246Blood pressure QTL 2463.6arterial blood pressure trait (VT:2000000)pulse pressure (CMO:0000292)1102813953218753816Rat
1300158Bp173Blood pressure QTL 1733.48arterial blood pressure trait (VT:2000000)blood pressure time series experimental set point of the baroreceptor response (CMO:0002593)1115540693185145286Rat
7794788Mcs32Mammary carcinoma susceptibility QTL 322.61mammary gland integrity trait (VT:0010552)mammary tumor incidence/prevalence measurement (CMO:0000946)1115540693238914717Rat
7421630Bp362Blood pressure QTL 3620.001arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)1118608292241799120Rat
631205Bp196Blood pressure QTL 19640.0001arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)1118944897199050459Rat
1358189Cstrr1Cold stress response QTL 10.0001catecholamine amount (VT:0010543)urine norepinephrine level (CMO:0001629)1123350408182418476Rat
1641895Bp298Blood pressure QTL 298arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)1123350408182418476Rat
1578770Stresp23Stress response QTL 23kidney sympathetic nerve activity (VT:0004050)stimulated renal sympathetic nerve activity to basal renal sympathetic nerve activity ratio (CMO:0001786)1123350408182418476Rat
631549Bp89Blood pressure QTL 895.7arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)1123350581201284552Rat
1598853Memor3Memory QTL 34.5exploratory behavior trait (VT:0010471)total horizontal distance resulting from voluntary locomotion in an experimental apparatus (CMO:0001443)1143506580212458660Rat
61348Bp30Blood pressure QTL 302.4arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)1144017057197814409Rat
70160Bw18Body weight QTL 185.7body mass (VT:0001259)body weight (CMO:0000012)1144267353196383668Rat
737828Hcas3Hepatocarcinoma susceptibility QTL 34.9liver integrity trait (VT:0010547)liver tumorous lesion volume to total liver volume ratio (CMO:0001082)1144267353222987745Rat
2302378Insul11Insulin level QTL 113.25blood insulin amount (VT:0001560)serum insulin level (CMO:0000358)1144267353251128347Rat
7771612Cm80Cardiac mass QTL 808.4heart left ventricle mass (VT:0007031)heart left ventricle weight (CMO:0000776)1149448574221264292Rat
724531Uae5Urinary albumin excretion QTL 54urine albumin amount (VT:0002871)urine albumin level (CMO:0000130)1150700142252085212Rat
1578759Uae30Urinary albumin excretion QTL 303.30.003urine albumin amount (VT:0002871)urine albumin excretion rate (CMO:0000757)1150700247252085048Rat
1578778Pur4Proteinuria QTL 43.30.003urine total protein amount (VT:0000032)urine total protein excretion rate (CMO:0000756)1150700247252085048Rat
1354602Bw35Body weight QTL 3512.2body mass (VT:0001259)body weight (CMO:0000012)1151162512201278233Rat
1354620Kidm19Kidney mass QTL 194kidney mass (VT:0002707)calculated kidney weight (CMO:0000160)1151162512201278233Rat
1354634Kidm12Kidney mass QTL 123.9kidney mass (VT:0002707)right kidney wet weight (CMO:0000082)1151162512201278233Rat
1354636Lmblg1Limb length QTL 16.4tibia length (VT:0004357)tibia length (CMO:0000450)1151162512201278233Rat
1354610Bw34Body weight QTL 344.1body mass (VT:0001259)body weight (CMO:0000012)1151162512256448636Rat
1354646Kidm18Kidney mass QTL 185.7kidney mass (VT:0002707)calculated kidney weight (CMO:0000160)1151162512256448636Rat
1354661Bw33Body weight QTL 335.2body mass (VT:0001259)body weight (CMO:0000012)1151162512256448636Rat
1358886Bp260Blood pressure QTL 2603.67arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)1151162766225824951Rat
61343Bp28Blood pressure QTL 28arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)1151646613196646613Rat
1549837Hcar15Hepatocarcinoma resistance QTL 150.05liver integrity trait (VT:0010547)liver tumorous lesion number (CMO:0001068)1153136852260522016Rat
2303622Vencon6Ventilatory control QTL 60.001respiration trait (VT:0001943)respiration rate (CMO:0000289)1154561505199561505Rat
4889428Stresp24Stress response QTL 240.05heart pumping trait (VT:2000009)absolute change in electrocardiographic low frequency R-R spectral component to high frequency R-R spectral component ratio (CMO:0002162)1155866514200866514Rat
1354618Kidm15Kidney mass QTL 155kidney mass (VT:0002707)left kidney wet weight (CMO:0000083)1156677124201278233Rat
2312420Pur17Proteinuria QTL 177.10.0001urine protein amount (VT:0005160)urine total protein excretion rate (CMO:0000756)1156677124218753816Rat
1354580Scort1Serum corticosterone level QTL 13.4blood corticosterone amount (VT:0005345)blood corticosterone level (CMO:0001172)1156677124256448636Rat
61347Bp197Blood pressure QTL 1974.2arterial blood pressure trait (VT:2000000)blood pressure measurement (CMO:0000003)1158633083203633083Rat
2292222Bp307Blood pressure QTL 3073.060.0014arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)1164310393213533942Rat
2292220Bp306Blood pressure QTL 3063.470.00087arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)1164310393243914901Rat
619613Bp77Blood pressure QTL 770.01arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)1164747424209747424Rat
619613Bp77Blood pressure QTL 770.01arterial blood pressure trait (VT:2000000)diastolic blood pressure (CMO:0000005)1164747424209747424Rat
2312558Glom17Glomerulus QTL 173.90.001kidney glomerulus morphology trait (VT:0005325)index of glomerular damage (CMO:0001135)1166532971191278129Rat
1354653Despr9Despair related QTL 90.00019locomotor behavior trait (VT:0001392)amount of experiment time spent in a discrete space in an experimental apparatus (CMO:0000958)1167909849212909849Rat
619614Bp78Blood pressure QTL 780.001arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)1169112897197261052Rat
619614Bp78Blood pressure QTL 780.001arterial blood pressure trait (VT:2000000)diastolic blood pressure (CMO:0000005)1169112897197261052Rat
61341Bp26Blood pressure QTL 26arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)1169537671214537671Rat
724562Rends1Renal damage susceptibility QTL 10.05kidney glomerulus integrity trait (VT:0010546)index of glomerular damage (CMO:0001135)1169537671214537671Rat
1358294Bw37Body weight QTL 3750.000011body mass (VT:0001259)body weight (CMO:0000012)1171310381216310381Rat
2293689Bss47Bone structure and strength QTL 477.250.0001lumbar vertebra size trait (VT:0010518)lumbar vertebra trabecular cross-sectional area (CMO:0001692)1171629477216629477Rat
2293693Bss22Bone structure and strength QTL 2233.520.0001femur morphology trait (VT:0000559)femur cross-sectional area (CMO:0001661)1171629477216629477Rat
2300161Bmd43Bone mineral density QTL 438.40.0001femur mineral mass (VT:0010011)volumetric bone mineral density (CMO:0001553)1171629477216629477Rat
2300174Bmd42Bone mineral density QTL 428.40.0001lumbar vertebra mineral mass (VT:0010511)bone mineral density (CMO:0001226)1171629477216629477Rat
2300187Bmd41Bone mineral density QTL 418.90.0001femur mineral mass (VT:0010011)volumetric bone mineral density (CMO:0001553)1171629477216629477Rat
2293654Bss30Bone structure and strength QTL 3032.650.0001femur strength trait (VT:0010010)femur midshaft polar moment of inertia (CMO:0001669)1171629477216629477Rat
2293673Bss27Bone structure and strength QTL 2718.630.0001femur morphology trait (VT:0000559)femur midshaft cortical cross-sectional area (CMO:0001663)1171629477216629477Rat
2293677Bss41Bone structure and strength QTL 419.380.0001lumbar vertebra size trait (VT:0010518)lumbar vertebra cross-sectional area (CMO:0001689)1171629477216629477Rat
1549830Bss1Bone structure and strength QTL 14.8femur strength trait (VT:0010010)femur ultimate force (CMO:0001675)1172609619217609619Rat
631214Bw61Body weight QTL613.40.0001intramuscular adipose amount (VT:0010044)intramuscular fat area (CMO:0001162)1173108781218108781Rat
631670Iddm10Insulin dependent diabetes mellitus QTL 101.9blood glucose amount (VT:0000188)plasma glucose level (CMO:0000042)1174133260196383668Rat
70163Bw20Body weight QTL 205.1body mass (VT:0001259)body weight (CMO:0000012)1174133260219133260Rat
738032Hcas5Hepatocarcinoma susceptibility QTL 53.12liver integrity trait (VT:0010547)liver tumorous lesion number (CMO:0001068)1176426412257976495Rat
1600380Niddm70Non-insulin dependent diabetes mellitus QTL 703.10.0008blood insulin amount (VT:0001560)plasma insulin level (CMO:0000342)1176550523221550523Rat
10059600Bp378Blood pressure QTL 3783.080.05arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)1176869060221869060Rat
1354624Cm35Cardiac mass QTL355.7heart left ventricle mass (VT:0007031)calculated heart weight (CMO:0000073)1177227632256448636Rat
1354652Kidm20Kidney mass QTL 204.3kidney mass (VT:0002707)calculated kidney weight (CMO:0000160)1177227632256448636Rat
1558658Bw59Body weight QTL 593.50.0003body mass (VT:0001259)body weight (CMO:0000012)1178784622223784622Rat
2325725Eae31Experimental allergic encephalomyelitis QTL 31nervous system integrity trait (VT:0010566)experimental autoimmune encephalomyelitis severity score (CMO:0001419)1178810256188377506Rat
634321Hc1Hypercalciuria QTL 12.91urine calcium amount (VT:0002985)urine calcium excretion rate (CMO:0000763)1178810256240830002Rat
1578763Kidm29Kidney mass QTL 293.30.0001kidney mass (VT:0002707)both kidneys wet weight (CMO:0000085)1179567751260522016Rat
1302787Stl25Serum triglyceride level QTL 252.70.0073blood triglyceride amount (VT:0002644)plasma triglyceride level (CMO:0000548)1180359209210702199Rat
6903303Scl34Serum cholesterol QTL 342.50.0033blood cholesterol amount (VT:0000180)plasma total cholesterol level (CMO:0000585)1180359209218108781Rat
737977Bp160Blood pressure QTL 1600.001arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)1181133855226133855Rat
61378Bp43Blood pressure QTL 4322.6arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)1181746937196383668Rat
724559Pancm1Pancreatic morphology QTL 17.1islet of Langerhans morphology trait (VT:0005215)pancreatic islet damage composite score (CMO:0001156)1181759564214537555Rat
2293083Iddm25Insulin dependent diabetes mellitus QTL 254.18blood glucose amount (VT:0000188)blood glucose level (CMO:0000046)1181829673224569684Rat


Additional Information

Database Acc Id Source(s)
NCBI Gene 100360847 UniSTS
  293508 UniSTS
  687804 UniSTS
  691879 UniSTS
UniSTS 507858 UniSTS