RH126066 Marker Search Result - Rat Genome Database

Send us a Message



Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   
Pathways

Marker: RH126066

Symbol: RH126066
Previously known as:
RGD ID: 5502639
Expected Size: 701 (bp)
Position
Rat AssemblyChrPosition (strand)SourceJBrowse
GRCr815104,446,079 - 104,446,780 (+)Marker Load Pipeline
mRatBN7.21598,039,208 - 98,039,909 (+)MAPPERmRatBN7.2
Rnor_6.015106,291,461 - 106,292,161NCBIRnor6.0
Rnor_5.015109,687,360 - 109,688,060UniSTSRnor5.0
RGSC_v3.415106,020,138 - 106,020,838UniSTSRGSC3.4
Celera1596,847,612 - 96,848,312UniSTS
Cytogenetic Map15q24UniSTS
Is Marker For: Genes:   Ipo5  


Annotation


References - curated
# Reference Title Reference Citation
1. UniSTS Pipeline RGD automated pipelines

Strains and Sequence

Sequence
 
Forward Primer GTAAACGTTTATTTGGAGTTAGTCTT
Reverse Primer ATCTACCGAAAATATTCAGTATAATTG
 

Region

Genes in Region
The following Genes overlap with this region.    Full Report CSV TAB Printer Analysis Tools
RGD IDSymbolNameChrStartStopSpecies
1308715Ipo5importin 515104397626104447985Rat



QTLs in Region (GRCr8)
The following QTLs overlap with this region.    Full Report CSV TAB Printer Gviewer
RGD IDSymbolNameLODP ValueTraitSub TraitChrStartStopSpecies
1300144Rf23Renal function QTL 233.61renal blood flow trait (VT:2000006)absolute change in renal vascular resistance (CMO:0001900)1544806773104695021Rat
1576315Schws6Schwannoma susceptibility QTL 60.0069nervous system integrity trait (VT:0010566)post-insult time of death (CMO:0002005)1560213984105213984Rat
1549844Bss7Bone structure and strength QTL 76.4femur strength trait (VT:0010010)femur midshaft polar moment of inertia (CMO:0001669)1582194914108192169Rat
2300326Plaw1Placental weight QTL 1150.005placenta mass (VT:0004257)placenta wet weight (CMO:0002088)1574735564106469153Rat
1300118Bp190Blood pressure QTL 1902.94arterial blood pressure trait (VT:2000000)blood pressure measurement (CMO:0000003)1588677086104695021Rat
1358354Srcrt5Stress Responsive Cort QTL 53.38blood corticosterone amount (VT:0005345)plasma corticosterone level (CMO:0001173)1582503470108192169Rat
70155Gcs1Gastric cancer susceptibility QTL13.8stomach morphology trait (VT:0000470)stomach tumor susceptibility score (CMO:0002043)1582714037106778197Rat
1300120Kidm7Kidney mass QTL 73.55kidney mass (VT:0002707)left kidney wet weight to body weight ratio (CMO:0001954)1588677086104695021Rat
1578646Bmd18Bone mineral density QTL 185.2femur mineral mass (VT:0010011)trabecular volumetric bone mineral density (CMO:0001729)1525285835104695021Rat
631655Bp126Blood pressure QTL 1264arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)1564571127108192169Rat
1578647Bmd17Bone mineral density QTL 174femur mineral mass (VT:0010011)total volumetric bone mineral density (CMO:0001728)1525285835104695021Rat
7411646Foco21Food consumption QTL 2123.70.001eating behavior trait (VT:0001431)feed conversion ratio (CMO:0001312)1584278281108192169Rat
2298549Neuinf12Neuroinflammation QTL 123.5nervous system integrity trait (VT:0010566)spinal cord beta-2 microglobulin mRNA level (CMO:0002125)1561710951106710951Rat
1641889Colcr6Colorectal carcinoma resistance QTL 62.90.0126intestine integrity trait (VT:0010554)benign colorectal tumor surface area measurement (CMO:0001799)1583700787108192169Rat
2313080Bss65Bone structure and strength QTL 653.90.0001long bone metaphysis morphology trait (VT:0000133)tibia midshaft total cross-sectional area (CMO:0001715)1567399137108192169Rat
1578660Bss19Bone structure and strength QTL 194.3femur morphology trait (VT:0000559)bone trabecular cross-sectional area (CMO:0002311)1525285835104695021Rat
2317055Aia10Adjuvant induced arthritis QTL 103.41joint integrity trait (VT:0010548)left rear ankle joint diameter (CMO:0002149)1582194914108192169Rat


Additional Information

Database Acc Id Source(s)
NCBI Gene 306182 UniSTS